1
0
mirror of https://github.com/BurntSushi/ripgrep.git synced 2025-06-09 14:07:45 +02:00
ripgrep/tests/regression.rs

1199 lines
36 KiB
Rust
Raw Normal View History

use crate::hay::SHERLOCK;
use crate::util::{sort_lines, Dir, TestCommand};
// See: https://github.com/BurntSushi/ripgrep/issues/16
rgtest!(r16, |dir: Dir, mut cmd: TestCommand| {
dir.create_dir(".git");
dir.create(".gitignore", "ghi/");
dir.create_dir("ghi");
dir.create_dir("def/ghi");
dir.create("ghi/toplevel.txt", "xyz");
dir.create("def/ghi/subdir.txt", "xyz");
cmd.arg("xyz").assert_err();
});
// See: https://github.com/BurntSushi/ripgrep/issues/25
rgtest!(r25, |dir: Dir, mut cmd: TestCommand| {
dir.create_dir(".git");
dir.create(".gitignore", "/llvm/");
dir.create_dir("src/llvm");
dir.create("src/llvm/foo", "test");
cmd.arg("test");
eqnice!("src/llvm/foo:test\n", cmd.stdout());
cmd.current_dir(dir.path().join("src"));
eqnice!("llvm/foo:test\n", cmd.stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/30
rgtest!(r30, |dir: Dir, mut cmd: TestCommand| {
dir.create(".gitignore", "vendor/**\n!vendor/manifest");
dir.create_dir("vendor");
dir.create("vendor/manifest", "test");
eqnice!("vendor/manifest:test\n", cmd.arg("test").stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/49
rgtest!(r49, |dir: Dir, mut cmd: TestCommand| {
dir.create(".gitignore", "foo/bar");
dir.create_dir("test/foo/bar");
dir.create("test/foo/bar/baz", "test");
cmd.arg("xyz").assert_err();
});
// See: https://github.com/BurntSushi/ripgrep/issues/50
rgtest!(r50, |dir: Dir, mut cmd: TestCommand| {
dir.create(".gitignore", "XXX/YYY/");
dir.create_dir("abc/def/XXX/YYY");
dir.create_dir("ghi/XXX/YYY");
dir.create("abc/def/XXX/YYY/bar", "test");
dir.create("ghi/XXX/YYY/bar", "test");
cmd.arg("xyz").assert_err();
});
// See: https://github.com/BurntSushi/ripgrep/issues/64
rgtest!(r64, |dir: Dir, mut cmd: TestCommand| {
dir.create_dir("dir");
dir.create_dir("foo");
dir.create("dir/abc", "");
dir.create("foo/abc", "");
eqnice!("foo/abc\n", cmd.arg("--files").arg("foo").stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/65
rgtest!(r65, |dir: Dir, mut cmd: TestCommand| {
dir.create_dir(".git");
dir.create(".gitignore", "a/");
dir.create_dir("a");
dir.create("a/foo", "xyz");
dir.create("a/bar", "xyz");
cmd.arg("xyz").assert_err();
});
// See: https://github.com/BurntSushi/ripgrep/issues/67
rgtest!(r67, |dir: Dir, mut cmd: TestCommand| {
dir.create_dir(".git");
dir.create(".gitignore", "/*\n!/dir");
dir.create_dir("dir");
dir.create_dir("foo");
dir.create("foo/bar", "test");
dir.create("dir/bar", "test");
eqnice!("dir/bar:test\n", cmd.arg("test").stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/87
rgtest!(r87, |dir: Dir, mut cmd: TestCommand| {
dir.create_dir(".git");
dir.create(".gitignore", "foo\n**no-vcs**");
dir.create("foo", "test");
cmd.arg("test").assert_err();
});
// See: https://github.com/BurntSushi/ripgrep/issues/90
rgtest!(r90, |dir: Dir, mut cmd: TestCommand| {
dir.create_dir(".git");
dir.create(".gitignore", "!.foo");
dir.create(".foo", "test");
eqnice!(".foo:test\n", cmd.arg("test").stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/93
rgtest!(r93, |dir: Dir, mut cmd: TestCommand| {
dir.create("foo", "192.168.1.1");
eqnice!("foo:192.168.1.1\n", cmd.arg(r"(\d{1,3}\.){3}\d{1,3}").stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/99
rgtest!(r99, |dir: Dir, mut cmd: TestCommand| {
dir.create("foo1", "test");
dir.create("foo2", "zzz");
dir.create("bar", "test");
eqnice!(
sort_lines("bar\ntest\n\nfoo1\ntest\n"),
sort_lines(&cmd.arg("-j1").arg("--heading").arg("test").stdout())
);
});
// See: https://github.com/BurntSushi/ripgrep/issues/105
rgtest!(r105_part1, |dir: Dir, mut cmd: TestCommand| {
dir.create("foo", "zztest");
eqnice!("foo:1:3:zztest\n", cmd.arg("--vimgrep").arg("test").stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/105
rgtest!(r105_part2, |dir: Dir, mut cmd: TestCommand| {
dir.create("foo", "zztest");
eqnice!("foo:1:3:zztest\n", cmd.arg("--column").arg("test").stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/127
rgtest!(r127, |dir: Dir, mut cmd: TestCommand| {
// Set up a directory hierarchy like this:
//
// .gitignore
// foo/
// sherlock
// watson
//
// Where `.gitignore` contains `foo/sherlock`.
//
// ripgrep should ignore 'foo/sherlock' giving us results only from
// 'foo/watson' but on Windows ripgrep will include both 'foo/sherlock' and
// 'foo/watson' in the search results.
dir.create_dir(".git");
dir.create(".gitignore", "foo/sherlock\n");
dir.create_dir("foo");
dir.create("foo/sherlock", SHERLOCK);
dir.create("foo/watson", SHERLOCK);
let expected = "\
foo/watson:For the Doctor Watsons of this world, as opposed to the Sherlock
foo/watson:be, to a very large extent, the result of luck. Sherlock Holmes
";
assert_eq!(expected, cmd.arg("Sherlock").stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/128
rgtest!(r128, |dir: Dir, mut cmd: TestCommand| {
dir.create_bytes("foo", b"01234567\x0b\n\x0b\n\x0b\n\x0b\nx");
eqnice!("foo:5:x\n", cmd.arg("-n").arg("x").stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/131
//
// TODO(burntsushi): Darwin doesn't like this test for some reason. Probably
// due to the weird file path.
#[cfg(not(target_os = "macos"))]
rgtest!(r131, |dir: Dir, mut cmd: TestCommand| {
dir.create_dir(".git");
dir.create(".gitignore", "TopÑapa");
dir.create("TopÑapa", "test");
cmd.arg("test").assert_err();
});
// See: https://github.com/BurntSushi/ripgrep/issues/137
//
// TODO(burntsushi): Figure out how to make this test work on Windows. Right
// now it gives "access denied" errors when trying to create a file symlink.
// For now, disable test on Windows.
#[cfg(not(windows))]
rgtest!(r137, |dir: Dir, mut cmd: TestCommand| {
dir.create("sherlock", SHERLOCK);
dir.link_file("sherlock", "sym1");
dir.link_file("sherlock", "sym2");
let expected = "\
./sherlock:For the Doctor Watsons of this world, as opposed to the Sherlock
./sherlock:be, to a very large extent, the result of luck. Sherlock Holmes
sym1:For the Doctor Watsons of this world, as opposed to the Sherlock
sym1:be, to a very large extent, the result of luck. Sherlock Holmes
sym2:For the Doctor Watsons of this world, as opposed to the Sherlock
sym2:be, to a very large extent, the result of luck. Sherlock Holmes
";
cmd.arg("-j1").arg("Sherlock").arg("./").arg("sym1").arg("sym2");
eqnice!(expected, cmd.stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/156
rgtest!(r156, |dir: Dir, mut cmd: TestCommand| {
let expected = r#"#parse('widgets/foo_bar_macros.vm')
#parse ( 'widgets/mobile/foo_bar_macros.vm' )
#parse ("widgets/foobarhiddenformfields.vm")
#parse ( "widgets/foo_bar_legal.vm" )
#include( 'widgets/foo_bar_tips.vm' )
#include('widgets/mobile/foo_bar_macros.vm')
#include ("widgets/mobile/foo_bar_resetpw.vm")
#parse('widgets/foo-bar-macros.vm')
#parse ( 'widgets/mobile/foo-bar-macros.vm' )
#parse ("widgets/foo-bar-hiddenformfields.vm")
#parse ( "widgets/foo-bar-legal.vm" )
#include( 'widgets/foo-bar-tips.vm' )
#include('widgets/mobile/foo-bar-macros.vm')
#include ("widgets/mobile/foo-bar-resetpw.vm")
"#;
dir.create("testcase.txt", expected);
cmd.arg("-N");
cmd.arg(r#"#(?:parse|include)\s*\(\s*(?:"|')[./A-Za-z_-]+(?:"|')"#);
cmd.arg("testcase.txt");
eqnice!(expected, cmd.stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/184
rgtest!(r184, |dir: Dir, mut cmd: TestCommand| {
dir.create(".gitignore", ".*");
dir.create_dir("foo/bar");
dir.create("foo/bar/baz", "test");
cmd.arg("test");
eqnice!("foo/bar/baz:test\n", cmd.stdout());
cmd.current_dir(dir.path().join("./foo/bar"));
eqnice!("baz:test\n", cmd.stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/199
rgtest!(r199, |dir: Dir, mut cmd: TestCommand| {
dir.create("foo", "tEsT");
eqnice!("foo:tEsT\n", cmd.arg("--smart-case").arg(r"\btest\b").stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/206
rgtest!(r206, |dir: Dir, mut cmd: TestCommand| {
dir.create_dir("foo");
dir.create("foo/bar.txt", "test");
cmd.arg("test").arg("-g").arg("*.txt");
eqnice!("foo/bar.txt:test\n", cmd.stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/210
#[cfg(unix)]
rgtest!(r210, |dir: Dir, mut cmd: TestCommand| {
use std::ffi::OsStr;
use std::os::unix::ffi::OsStrExt;
let badutf8 = OsStr::from_bytes(&b"foo\xffbar"[..]);
// APFS does not support creating files with invalid UTF-8 bytes.
// https://github.com/BurntSushi/ripgrep/issues/559
if dir.try_create(badutf8, "test").is_ok() {
cmd.arg("-H").arg("test").arg(badutf8);
assert_eq!(b"foo\xffbar:test\n".to_vec(), cmd.output().stdout);
}
});
// See: https://github.com/BurntSushi/ripgrep/issues/228
rgtest!(r228, |dir: Dir, mut cmd: TestCommand| {
dir.create_dir("foo");
cmd.arg("--ignore-file").arg("foo").arg("test").assert_err();
});
// See: https://github.com/BurntSushi/ripgrep/issues/229
rgtest!(r229, |dir: Dir, mut cmd: TestCommand| {
dir.create("foo", "economie");
cmd.arg("-S").arg("[E]conomie").assert_err();
});
// See: https://github.com/BurntSushi/ripgrep/issues/251
rgtest!(r251, |dir: Dir, mut cmd: TestCommand| {
dir.create("foo", "привет\nПривет\nПрИвЕт");
let expected = "foo:привет\nfoo:Привет\nfoo:ПрИвЕт\n";
eqnice!(expected, cmd.arg("-i").arg("привет").stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/256
#[cfg(not(windows))]
rgtest!(r256, |dir: Dir, mut cmd: TestCommand| {
dir.create_dir("bar");
dir.create("bar/baz", "test");
dir.link_dir("bar", "foo");
eqnice!("foo/baz:test\n", cmd.arg("test").arg("foo").stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/256
#[cfg(not(windows))]
rgtest!(r256_j1, |dir: Dir, mut cmd: TestCommand| {
dir.create_dir("bar");
dir.create("bar/baz", "test");
dir.link_dir("bar", "foo");
eqnice!("foo/baz:test\n", cmd.arg("-j1").arg("test").arg("foo").stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/270
rgtest!(r270, |dir: Dir, mut cmd: TestCommand| {
dir.create("foo", "-test");
cmd.arg("-e").arg("-test");
eqnice!("foo:-test\n", cmd.stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/279
rgtest!(r279, |dir: Dir, mut cmd: TestCommand| {
dir.create("foo", "test");
eqnice!("", cmd.arg("-q").arg("test").stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/391
rgtest!(r391, |dir: Dir, mut cmd: TestCommand| {
dir.create_dir(".git");
dir.create("lock", "");
dir.create("bar.py", "");
dir.create(".git/packed-refs", "");
dir.create(".git/description", "");
cmd.args(&[
"--no-ignore",
"--hidden",
"--follow",
"--files",
"--glob",
"!{.git,node_modules,plugged}/**",
"--glob",
"*.{js,json,php,md,styl,scss,sass,pug,html,config,py,cpp,c,go,hs}",
]);
eqnice!("bar.py\n", cmd.stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/405
rgtest!(r405, |dir: Dir, mut cmd: TestCommand| {
dir.create_dir("foo/bar");
dir.create_dir("bar/foo");
dir.create("foo/bar/file1.txt", "test");
dir.create("bar/foo/file2.txt", "test");
cmd.arg("-g").arg("!/foo/**").arg("test");
eqnice!("bar/foo/file2.txt:test\n", cmd.stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/428
#[cfg(not(windows))]
rgtest!(r428_color_context_path, |dir: Dir, mut cmd: TestCommand| {
dir.create("sherlock", "foo\nbar");
cmd.args(&[
"-A1",
"-H",
"--no-heading",
"-N",
"--colors=match:none",
"--color=always",
"--hyperlink-format=",
"foo",
]);
let expected = format!(
"{colored_path}:foo\n{colored_path}-bar\n",
colored_path =
"\x1b\x5b\x30\x6d\x1b\x5b\x33\x35\x6dsherlock\x1b\x5b\x30\x6d"
);
eqnice!(expected, cmd.stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/428
rgtest!(r428_unrecognized_style, |dir: Dir, mut cmd: TestCommand| {
dir.create("file.txt", "Sherlock");
cmd.arg("--colors=match:style:").arg("Sherlock");
cmd.assert_err();
let output = cmd.cmd().output().unwrap();
let stderr = String::from_utf8_lossy(&output.stderr);
let expected = "\
cli: replace clap with lexopt and supporting code ripgrep began it's life with docopt for argument parsing. Then it moved to Clap and stayed there for a number of years. Clap has served ripgrep well, and it probably could continue to serve ripgrep well, but I ended up deciding to move off of it. Why? The first time I had the thought of moving off of Clap was during the 2->3->4 transition. I thought the 3.x and 4.x releases were great, but for me, it ended up moving a little too quickly. Since the release of 4.x was telegraphed around when 3.x came out, I decided to just hold off and wait to migrate to 4.x instead of doing a 3.x migration followed shortly by another 4.x migration. Of course, I just never ended up doing the migration at all. I never got around to it and there just wasn't a compelling reason for me to upgrade. While I never investigated it, I saw an upgrade as a non-trivial amount of work in part because I didn't encapsulate the usage of Clap enough. The above is just what got me started thinking about it. It wasn't enough to get me to move off of it on its own. What ended up pushing me over the edge was a combination of factors: * As mentioned above, I didn't want to run on the migration treadmill. This has proven to not be much of an issue, but at the time of the 2->3->4 releases, I didn't know how long Clap 4.x would be out before a 5.x would come out. * The release of lexopt[1] caught my eye. IMO, that crate demonstrates exactly how something new can arrive on the scene and just thoroughly solve a problem minimalistically. It has the docs, the reasoning, the simple API, the tests and good judgment. It gets all the weird corner cases right that Clap also gets right (and is part of why I was originally attracted to Clap). * I have an overall desire to reduce the size of my dependency tree. In part because a smaller dependency tree tends to correlate with better compile times, but also in part because it reduces my reliance and trust on others. It lets me be the "master" of ripgrep's destiny by reducing the amount of behavior that is the result of someone else's decision (whether good or bad). * I perceived that Clap solves a more general problem than what I actually need solved. Despite the vast number of flags that ripgrep has, its requirements are actually pretty simple. We just need simple switches and flags that support one value. No multi-value flags. No sub-commands. And probably a lot of other functionality that Clap has that makes it so flexible for so many different use cases. (I'm being hand wavy on the last point.) With all that said, perhaps most importantly, the future of ripgrep possibly demands a more flexible CLI argument parser. In today's world, I would really like, for example, flags like `--type` and `--type-not` to be able to accumulate their repeated values into a single sequence while respecting the order they appear on the CLI. For example, prior to this migration, `rg regex-automata -Tlock -ttoml` would not return results in `Cargo.lock` in this repository because the `-Tlock` always took priority even though `-ttoml` appeared after it. But with this migration, `-ttoml` now correctly overrides `-Tlock`. We would like to do similar things for `-g/--glob` and `--iglob` and potentially even now introduce a `-G/--glob-not` flag instead of requiring users to use `!` to negate a glob. (Which I had done originally to work-around this problem.) And some day, I'd like to add some kind of boolean matching to ripgrep perhaps similar to how `git grep` does it. (Although I haven't thought too carefully on a design yet.) In order to do that, I perceive it would be difficult to implement correctly in Clap. I believe that this last point is possible to implement correctly in Clap 2.x, although it is awkward to do so. I have not looked closely enough at the Clap 4.x API to know whether it's still possible there. In any case, these were enough reasons to move off of Clap and own more of the argument parsing process myself. This did require a few things: * I had to write my own logic for how arguments are combined into one single state object. Of course, I wanted this. This was part of the upside. But it's still code I didn't have to write for Clap. * I had to write my own shell completion generator. * I had to write my own `-h/--help` output generator. * I also had to write my own man page generator. Well, I had to do this with Clap 2.x too, although my understanding is that Clap 4.x supports this. With that said, without having tried it, my guess is that I probably wouldn't have liked the output it generated because I ultimately had to write most of the roff by hand myself to get the man page I wanted. (This also had the benefit of dropping the build dependency on asciidoc/asciidoctor.) While this is definitely a fair bit of extra work, it overall only cost me a couple days. IMO, that's a good trade off given that this code is unlikely to change again in any substantial way. And it should also allow for more flexible semantics going forward. Fixes #884, Fixes #1648, Fixes #1701, Fixes #1814, Fixes #1966 [1]: https://docs.rs/lexopt/0.3.0/lexopt/index.html
2023-10-16 18:05:39 -04:00
error parsing flag --colors: \
unrecognized style attribute ''. Choose from: nobold, bold, nointense, \
intense, nounderline, underline.
";
eqnice!(expected, stderr);
});
// See: https://github.com/BurntSushi/ripgrep/issues/451
rgtest!(r451_only_matching_as_in_issue, |dir: Dir, mut cmd: TestCommand| {
dir.create("digits.txt", "1 2 3\n");
cmd.arg("--only-matching").arg(r"[0-9]+").arg("digits.txt");
let expected = "\
1
2
3
";
eqnice!(expected, cmd.stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/451
rgtest!(r451_only_matching, |dir: Dir, mut cmd: TestCommand| {
dir.create("digits.txt", "1 2 3\n123\n");
cmd.args(&["--only-matching", "--column", r"[0-9]", "digits.txt"]);
let expected = "\
1:1:1
1:3:2
1:5:3
2:1:1
2:2:2
2:3:3
";
eqnice!(expected, cmd.stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/483
rgtest!(r483_matching_no_stdout, |dir: Dir, mut cmd: TestCommand| {
dir.create("file.py", "");
cmd.arg("--quiet").arg("--files").arg("--glob").arg("*.py");
eqnice!("", cmd.stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/483
rgtest!(r483_non_matching_exit_code, |dir: Dir, mut cmd: TestCommand| {
dir.create("file.rs", "");
cmd.arg("--quiet").arg("--files").arg("--glob").arg("*.py");
cmd.assert_err();
});
// See: https://github.com/BurntSushi/ripgrep/issues/493
rgtest!(r493, |dir: Dir, mut cmd: TestCommand| {
dir.create("input.txt", "peshwaship 're seminomata");
cmd.arg("-o").arg(r"\b 're \b").arg("input.txt");
assert_eq!(" 're \n", cmd.stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/506
rgtest!(r506_word_not_parenthesized, |dir: Dir, mut cmd: TestCommand| {
dir.create("wb.txt", "min minimum amin\nmax maximum amax");
cmd.arg("-w").arg("-o").arg("min|max").arg("wb.txt");
eqnice!("min\nmax\n", cmd.stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/553
rgtest!(r553_switch, |dir: Dir, mut cmd: TestCommand| {
dir.create("sherlock", SHERLOCK);
let expected = "\
sherlock:For the Doctor Watsons of this world, as opposed to the Sherlock
sherlock:be, to a very large extent, the result of luck. Sherlock Holmes
";
cmd.arg("-i").arg("sherlock");
eqnice!(expected, cmd.stdout());
// Repeat the `i` flag to make sure everything still works.
eqnice!(expected, cmd.arg("-i").stdout());
});
rgtest!(r553_flag, |dir: Dir, mut cmd: TestCommand| {
dir.create("sherlock", SHERLOCK);
let expected = "\
For the Doctor Watsons of this world, as opposed to the Sherlock
Holmeses, success in the province of detective work must always
--
but Doctor Watson has to have it taken out for him and dusted,
and exhibited clearly, with a label attached.
";
cmd.arg("-C").arg("1").arg(r"world|attached").arg("sherlock");
eqnice!(expected, cmd.stdout());
let expected = "\
For the Doctor Watsons of this world, as opposed to the Sherlock
and exhibited clearly, with a label attached.
";
eqnice!(expected, cmd.arg("-C").arg("0").stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/568
rgtest!(r568_leading_hyphen_option_args, |dir: Dir, mut cmd: TestCommand| {
dir.create("file", "foo bar -baz\n");
cmd.arg("-e-baz").arg("-e").arg("-baz").arg("file");
eqnice!("foo bar -baz\n", cmd.stdout());
let mut cmd = dir.command();
cmd.arg("-rni").arg("bar").arg("file");
eqnice!("foo ni -baz\n", cmd.stdout());
let mut cmd = dir.command();
cmd.arg("-r").arg("-n").arg("-i").arg("bar").arg("file");
eqnice!("foo -n -baz\n", cmd.stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/599
//
// This test used to check that we emitted color escape sequences even for
// empty matches, but with the addition of the JSON output format, clients no
// longer need to rely on escape sequences to parse matches. Therefore, we no
// longer emit useless escape sequences.
rgtest!(r599, |dir: Dir, mut cmd: TestCommand| {
dir.create("input.txt", "\n\ntest\n");
cmd.args(&[
"--color",
"ansi",
"--colors",
"path:none",
"--colors",
"line:none",
"--colors",
"match:fg:red",
"--colors",
"match:style:nobold",
"--line-number",
r"^$",
"input.txt",
]);
let expected = "\
1:
2:
";
eqnice_repr!(expected, cmd.stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/693
rgtest!(r693_context_in_contextless_mode, |dir: Dir, mut cmd: TestCommand| {
dir.create("foo", "xyz\n");
dir.create("bar", "xyz\n");
cmd.arg("-C1").arg("-c").arg("--sort-files").arg("xyz");
eqnice!("bar:1\nfoo:1\n", cmd.stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/807
rgtest!(r807, |dir: Dir, mut cmd: TestCommand| {
dir.create_dir(".git");
dir.create(".gitignore", ".a/b");
dir.create_dir(".a/b");
dir.create_dir(".a/c");
dir.create(".a/b/file", "test");
dir.create(".a/c/file", "test");
eqnice!(".a/c/file:test\n", cmd.arg("--hidden").arg("test").stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/900
rgtest!(r900, |dir: Dir, mut cmd: TestCommand| {
dir.create("sherlock", SHERLOCK);
dir.create("pat", "");
cmd.arg("-fpat").arg("sherlock").assert_err();
});
// See: https://github.com/BurntSushi/ripgrep/issues/1064
rgtest!(r1064, |dir: Dir, mut cmd: TestCommand| {
dir.create("input", "abc");
eqnice!("input:abc\n", cmd.arg("a(.*c)").stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/1174
rgtest!(r1098, |dir: Dir, mut cmd: TestCommand| {
dir.create_dir(".git");
dir.create(".gitignore", "a**b");
dir.create("afoob", "test");
cmd.arg("test").assert_err();
});
// See: https://github.com/BurntSushi/ripgrep/issues/1130
rgtest!(r1130, |dir: Dir, mut cmd: TestCommand| {
dir.create("foo", "test");
eqnice!(
"foo\n",
cmd.arg("--files-with-matches").arg("test").arg("foo").stdout()
);
let mut cmd = dir.command();
eqnice!(
"foo\n",
cmd.arg("--files-without-match").arg("nada").arg("foo").stdout()
);
});
// See: https://github.com/BurntSushi/ripgrep/issues/1159
rgtest!(r1159_invalid_flag, |_: Dir, mut cmd: TestCommand| {
cmd.arg("--wat").assert_exit_code(2);
});
// See: https://github.com/BurntSushi/ripgrep/issues/1159
rgtest!(r1159_exit_status, |dir: Dir, _: TestCommand| {
dir.create("foo", "test");
// search with a match gets 0 exit status.
let mut cmd = dir.command();
cmd.arg("test").assert_exit_code(0);
// search with --quiet and a match gets 0 exit status.
let mut cmd = dir.command();
cmd.arg("-q").arg("test").assert_exit_code(0);
// search with a match and an error gets 2 exit status.
let mut cmd = dir.command();
cmd.arg("test").arg("no-file").assert_exit_code(2);
// search with a match in --quiet mode and an error gets 0 exit status.
let mut cmd = dir.command();
cmd.arg("-q").arg("test").arg("foo").arg("no-file").assert_exit_code(0);
// search with no match gets 1 exit status.
let mut cmd = dir.command();
cmd.arg("nada").assert_exit_code(1);
// search with --quiet and no match gets 1 exit status.
let mut cmd = dir.command();
cmd.arg("-q").arg("nada").assert_exit_code(1);
// search with no match and an error gets 2 exit status.
let mut cmd = dir.command();
cmd.arg("nada").arg("no-file").assert_exit_code(2);
// search with no match in --quiet mode and an error gets 2 exit status.
let mut cmd = dir.command();
cmd.arg("-q").arg("nada").arg("foo").arg("no-file").assert_exit_code(2);
});
// See: https://github.com/BurntSushi/ripgrep/issues/1163
rgtest!(r1163, |dir: Dir, mut cmd: TestCommand| {
dir.create("bom.txt", "\u{FEFF}test123\ntest123");
eqnice!(
"bom.txt:test123\nbom.txt:test123\n",
cmd.arg("^test123").stdout()
);
});
// See: https://github.com/BurntSushi/ripgrep/issues/1164
rgtest!(r1164, |dir: Dir, mut cmd: TestCommand| {
dir.create_dir(".git");
dir.create(".gitignore", "myfile");
dir.create("MYFILE", "test");
cmd.arg("--ignore-file-case-insensitive").arg("test").assert_err();
eqnice!(
"MYFILE:test\n",
cmd.arg("--no-ignore-file-case-insensitive").stdout()
);
});
// See: https://github.com/BurntSushi/ripgrep/issues/1173
rgtest!(r1173, |dir: Dir, mut cmd: TestCommand| {
dir.create_dir(".git");
dir.create(".gitignore", "**");
dir.create("foo", "test");
cmd.arg("test").assert_err();
});
// See: https://github.com/BurntSushi/ripgrep/issues/1174
rgtest!(r1174, |dir: Dir, mut cmd: TestCommand| {
dir.create_dir(".git");
dir.create(".gitignore", "**/**/*");
dir.create_dir("a");
dir.create("a/foo", "test");
cmd.arg("test").assert_err();
});
// See: https://github.com/BurntSushi/ripgrep/issues/1176
rgtest!(r1176_literal_file, |dir: Dir, mut cmd: TestCommand| {
dir.create("patterns", "foo(bar\n");
dir.create("test", "foo(bar");
eqnice!(
"foo(bar\n",
cmd.arg("-F").arg("-f").arg("patterns").arg("test").stdout()
);
});
// See: https://github.com/BurntSushi/ripgrep/issues/1176
rgtest!(r1176_line_regex, |dir: Dir, mut cmd: TestCommand| {
dir.create("patterns", "foo\n");
dir.create("test", "foobar\nfoo\nbarfoo\n");
eqnice!(
"foo\n",
cmd.arg("-x").arg("-f").arg("patterns").arg("test").stdout()
);
});
// See: https://github.com/BurntSushi/ripgrep/issues/1203
rgtest!(r1203_reverse_suffix_literal, |dir: Dir, _: TestCommand| {
dir.create("test", "153.230000\n");
let mut cmd = dir.command();
eqnice!("153.230000\n", cmd.arg(r"\d\d\d00").arg("test").stdout());
let mut cmd = dir.command();
eqnice!("153.230000\n", cmd.arg(r"\d\d\d000").arg("test").stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/1223
rgtest!(
r1223_no_dir_check_for_default_path,
|dir: Dir, mut cmd: TestCommand| {
dir.create_dir("-");
dir.create("a.json", "{}");
dir.create("a.txt", "some text");
eqnice!(
"a.json\na.txt\n",
sort_lines(&cmd.arg("a").pipe(b"a.json\na.txt"))
);
}
);
// See: https://github.com/BurntSushi/ripgrep/issues/1259
rgtest!(r1259_drop_last_byte_nonl, |dir: Dir, mut cmd: TestCommand| {
dir.create("patterns-nonl", "[foo]");
dir.create("patterns-nl", "[foo]\n");
dir.create("test", "fz");
eqnice!("fz\n", cmd.arg("-f").arg("patterns-nonl").arg("test").stdout());
cmd = dir.command();
eqnice!("fz\n", cmd.arg("-f").arg("patterns-nl").arg("test").stdout());
});
printer: fix multi-line replacement bug This commit fixes a subtle bug in multi-line replacement of line terminators. The problem is that even though ripgrep supports multi-line searches, it is *still* line oriented. It still needs to print line numbers, for example. For this reason, there are various parts in the printer that iterate over lines in order to format them into the desired output. This turns out to be problematic in some cases. #1311 documents one of those cases (with line numbers enabled to highlight a point later): $ printf "hello\nworld\n" | rg -n -U "\n" -r "?" 1:hello? 2:world? But the desired output is this: $ printf "hello\nworld\n" | rg -n -U "\n" -r "?" 1:hello?world? At first I had thought that the main problem was that the printer was taking ownership of writing line terminators, even if the input already had them. But it's more subtle than that. If we fix that issue, we get output like this instead: $ printf "hello\nworld\n" | rg -n -U "\n" -r "?" 1:hello?2:world? Notice how '2:' is printed before 'world?'. The reason it works this way is because matches are reported to the printer in a line oriented way. That is, the printer gets a block of lines. The searcher guarantees that all matches that start or end in any of those lines also end or start in another line in that same block. As a result, the printer uses this assumption: once it has processed a block of lines, the next match will begin on a new and distinct line. Thus, things like '2:' are printed. This is generally all fine and good, but an impedance mismatch arises when replacements are used. Because now, the replacement can be used to change the "block of lines" approach. Now, in terms of the output, the subsequent match might actually continue the current line since the replacement might get rid of the concept of lines altogether. We can sometimes work around this. For example: $ printf "hello\nworld\n" | rg -U "\n(.)?" -r '?$1' hello?world? Why does this work? It's because the '(.)' after the '\n' causes the match to overlap between lines. Thus, the searcher guarantees that the block sent to the printer contains every line. And there in lay the solution: all we need to do is tweak the multi-line searcher so that it combines lines with matches that directly adjacent, instead of requiring at least one byte of overlap. Fixing that solves the issue above. It does cause some tests to fail: * The binary3 test in the searcher crate fails because adjacent line matches are now one part of block, and that block is scanned for binary data. To preserve the essence of the test, we insert a couple dummy lines to split up the blocks. * The JSON CRLF test. It was testing that we didn't output any messages with an empty 'submatches' array. That is indeed still the case. The difference is that the messages got combined because of the adjacent line merging behavior. This is a slight change to the output, but is still correct. Fixes #1311
2021-05-31 06:10:48 -04:00
// See: https://github.com/BurntSushi/ripgrep/issues/1311
rgtest!(r1311_multi_line_term_replace, |dir: Dir, mut cmd: TestCommand| {
dir.create("input", "hello\nworld\n");
eqnice!(
"1:hello?world?\n",
cmd.args(&["-U", "-r?", "-n", "\n", "input"]).stdout()
);
});
// See: https://github.com/BurntSushi/ripgrep/issues/1319
rgtest!(r1319, |dir: Dir, mut cmd: TestCommand| {
dir.create("input", "CCAGCTACTCGGGAGGCTGAGGCTGGAGGATCGCTTGAGTCCAGGAGTTC");
eqnice!(
"input:CCAGCTACTCGGGAGGCTGAGGCTGGAGGATCGCTTGAGTCCAGGAGTTC\n",
cmd.arg("TTGAGTCCAGGAG[ATCG]{2}C").stdout()
);
});
// See: https://github.com/BurntSushi/ripgrep/issues/1334
rgtest!(r1334_crazy_literals, |dir: Dir, mut cmd: TestCommand| {
dir.create("patterns", &"1.208.0.0/12\n".repeat(40));
dir.create("corpus", "1.208.0.0/12\n");
eqnice!(
"1.208.0.0/12\n",
cmd.arg("-Ff").arg("patterns").arg("corpus").stdout()
);
});
// See: https://github.com/BurntSushi/ripgrep/issues/1380
rgtest!(r1380, |dir: Dir, mut cmd: TestCommand| {
dir.create(
"foo",
"\
a
b
c
d
e
d
e
d
e
d
e
",
);
eqnice!("d\ne\nd\n", cmd.args(&["-A2", "-m1", "d", "foo"]).stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/1389
rgtest!(r1389_bad_symlinks_no_biscuit, |dir: Dir, mut cmd: TestCommand| {
dir.create_dir("mydir");
dir.create("mydir/file.txt", "test");
dir.link_dir("mydir", "mylink");
let stdout = cmd
.args(&["test", "--no-ignore", "--sort", "path", "mylink"])
.stdout();
eqnice!("mylink/file.txt:test\n", stdout);
});
// See: https://github.com/BurntSushi/ripgrep/issues/1401
rgtest!(r1401_look_ahead_only_matching_1, |dir: Dir, mut cmd: TestCommand| {
// Only PCRE2 supports look-around.
if !dir.is_pcre2() {
return;
}
dir.create("ip.txt", "foo 42\nxoyz\ncat\tdog\n");
cmd.args(&["-No", r".*o(?!.*\s)", "ip.txt"]);
eqnice!("xo\ncat\tdo\n", cmd.stdout());
let mut cmd = dir.command();
cmd.args(&["-No", r".*o(?!.*[ \t])", "ip.txt"]);
eqnice!("xo\ncat\tdo\n", cmd.stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/1401
rgtest!(r1401_look_ahead_only_matching_2, |dir: Dir, mut cmd: TestCommand| {
// Only PCRE2 supports look-around.
if !dir.is_pcre2() {
return;
}
dir.create("ip.txt", "foo 42\nxoyz\ncat\tdog\nfoo");
cmd.args(&["-No", r".*o(?!.*\s)", "ip.txt"]);
eqnice!("xo\ncat\tdo\nfoo\n", cmd.stdout());
});
grep: fix bugs in handling multi-line look-around This commit hacks in a bug fix for handling look-around across multiple lines. The main problem is that by the time the matching lines are sent to the printer, the surrounding context---which some look-behind or look-ahead might have matched---could have been dropped if it wasn't part of the set of matching lines. Therefore, when the printer re-runs the regex engine in some cases (to do replacements, color matches, etc etc), it won't be guaranteed to see the same matches that the searcher found. Overall, this is a giant clusterfuck and suggests that the way I divided the abstraction boundary between the printer and the searcher is just wrong. It's likely that the searcher needs to handle more of the work of matching and pass that info on to the printer. The tricky part is that this additional work isn't always needed. Ultimately, this means a serious re-design of the interface between searching and printing. Sigh. The way this fix works is to smuggle the underlying buffer used by the searcher through into the printer. Since these bugs only impact multi-line search (otherwise, searches are only limited to matches across a single line), and since multi-line search always requires having the entire file contents in a single contiguous slice (memory mapped or on the heap), it follows that the buffer we pass through when we need it is, in fact, the entire haystack. So this commit refactors the printer's regex searching to use that buffer instead of the intended bundle of bytes containing just the relevant matching portions of that same buffer. There is one last little hiccup: PCRE2 doesn't seem to have a way to specify an ending position for a search. So when we re-run the search to find matches, we can't say, "but don't search past here." Since the buffer is likely to contain the entire file, we really cannot do anything here other than specify a fixed upper bound on the number of bytes to search. So if look-ahead goes more than N bytes beyond the match, this code will break by simply being unable to find the match. In practice, this is probably pretty rare. I believe that if we did a better fix for this bug by fixing the interfaces, then we'd probably try to have PCRE2 find the pertinent matches up front so that it never needs to re-discover them. Fixes #1412
2021-05-31 08:29:01 -04:00
// See: https://github.com/BurntSushi/ripgrep/issues/1412
rgtest!(r1412_look_behind_no_replacement, |dir: Dir, mut cmd: TestCommand| {
// Only PCRE2 supports look-around.
if !dir.is_pcre2() {
return;
}
dir.create("test", "foo\nbar\n");
cmd.args(&["-nU", "-rquux", r"(?<=foo\n)bar", "test"]);
eqnice!("2:quux\n", cmd.stdout());
});
// See: https://github.com/BurntSushi/ripgrep/pull/1446
rgtest!(
r1446_respect_excludes_in_worktree,
|dir: Dir, mut cmd: TestCommand| {
dir.create_dir("repo/.git/info");
dir.create("repo/.git/info/exclude", "ignored");
dir.create_dir("repo/.git/worktrees/repotree");
dir.create("repo/.git/worktrees/repotree/commondir", "../..");
dir.create_dir("repotree");
dir.create("repotree/.git", "gitdir: repo/.git/worktrees/repotree");
dir.create("repotree/ignored", "");
dir.create("repotree/not-ignored", "");
cmd.arg("--sort").arg("path").arg("--files").arg("repotree");
eqnice!("repotree/not-ignored\n", cmd.stdout());
}
);
// See: https://github.com/BurntSushi/ripgrep/issues/1537
rgtest!(r1537, |dir: Dir, mut cmd: TestCommand| {
dir.create("foo", "abc;de,fg");
let expected = "foo:abc;de,fg\n";
eqnice!(expected, cmd.arg(";(.*,){1}").stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/1559
rgtest!(r1559, |dir: Dir, mut cmd: TestCommand| {
dir.create(
"foo",
"\
type A struct {
TaskID int `json:\"taskID\"`
}
type B struct {
ObjectID string `json:\"objectID\"`
TaskID int `json:\"taskID\"`
}
",
);
let expected = "\
foo: TaskID int `json:\"taskID\"`
foo: TaskID int `json:\"taskID\"`
";
eqnice!(expected, cmd.arg("TaskID +int").stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/1573
//
// Tests that if look-ahead is used, then --count-matches is correct.
rgtest!(r1573, |dir: Dir, mut cmd: TestCommand| {
// Only PCRE2 supports look-ahead.
if !dir.is_pcre2() {
return;
}
dir.create_bytes("foo", b"\xFF\xFE\x00\x62");
dir.create(
"foo",
"\
def A;
def B;
use A;
use B;
",
);
// Check that normal --count is correct.
cmd.args(&[
"--pcre2",
"--multiline",
"--count",
r"(?s)def (\w+);(?=.*use \w+)",
"foo",
]);
eqnice!("2\n", cmd.stdout());
// Now check --count-matches.
let mut cmd = dir.command();
cmd.args(&[
"--pcre2",
"--multiline",
"--count-matches",
r"(?s)def (\w+);(?=.*use \w+)",
"foo",
]);
eqnice!("2\n", cmd.stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/1638
//
// Tests if UTF-8 BOM is sniffed, then the column index is correct.
rgtest!(r1638, |dir: Dir, mut cmd: TestCommand| {
dir.create_bytes("foo", b"\xef\xbb\xbfx");
eqnice!("foo:1:1:x\n", cmd.arg("--column").arg("x").stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/1739
rgtest!(r1739_replacement_lineterm_match, |dir: Dir, mut cmd: TestCommand| {
dir.create("test", "a\n");
cmd.args(&[r"-r${0}f", r".*", "test"]);
eqnice!("af\n", cmd.stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/1757
rgtest!(f1757, |dir: Dir, _: TestCommand| {
dir.create_dir("rust/target");
dir.create(".ignore", "rust/target");
dir.create("rust/source.rs", "needle");
dir.create("rust/target/rustdoc-output.html", "needle");
let args = &["--files-with-matches", "needle", "rust"];
eqnice!("rust/source.rs\n", dir.command().args(args).stdout());
let args = &["--files-with-matches", "needle", "./rust"];
eqnice!("./rust/source.rs\n", dir.command().args(args).stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/1765
rgtest!(r1765, |dir: Dir, mut cmd: TestCommand| {
dir.create("test", "\n");
// We need to add --color=always here to force the failure, since the bad
// code path is only triggered when colors are enabled.
cmd.args(&[r"x?", "--crlf", "--color", "always"]);
assert!(!cmd.stdout().is_empty());
});
rgtest!(r1866, |dir: Dir, mut cmd: TestCommand| {
dir.create("test", "foobar\nfoobar\nfoo quux");
cmd.args(&[
"--multiline",
"--vimgrep",
r"foobar\nfoobar\nfoo|quux",
"test",
]);
// vimgrep only wants the first line of each match, even when a match
// spans multiple lines.
//
// See: https://github.com/BurntSushi/ripgrep/issues/1866
let expected = "\
test:1:1:foobar
test:3:5:foo quux
";
eqnice!(expected, cmd.stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/1868
rgtest!(r1868_context_passthru_override, |dir: Dir, _: TestCommand| {
dir.create("test", "foo\nbar\nbaz\nquux\n");
let args = &["-C1", "bar", "test"];
eqnice!("foo\nbar\nbaz\n", dir.command().args(args).stdout());
let args = &["--passthru", "bar", "test"];
eqnice!("foo\nbar\nbaz\nquux\n", dir.command().args(args).stdout());
let args = &["--passthru", "-C1", "bar", "test"];
eqnice!("foo\nbar\nbaz\n", dir.command().args(args).stdout());
let args = &["-C1", "--passthru", "bar", "test"];
eqnice!("foo\nbar\nbaz\nquux\n", dir.command().args(args).stdout());
let args = &["--passthru", "-B1", "bar", "test"];
eqnice!("foo\nbar\n", dir.command().args(args).stdout());
let args = &["-B1", "--passthru", "bar", "test"];
eqnice!("foo\nbar\nbaz\nquux\n", dir.command().args(args).stdout());
let args = &["--passthru", "-A1", "bar", "test"];
eqnice!("bar\nbaz\n", dir.command().args(args).stdout());
let args = &["-A1", "--passthru", "bar", "test"];
eqnice!("foo\nbar\nbaz\nquux\n", dir.command().args(args).stdout());
});
rgtest!(r1878, |dir: Dir, _: TestCommand| {
dir.create("test", "a\nbaz\nabc\n");
// Since ripgrep enables (?m) by default, '^' will match at the beginning
// of a line, even when -U/--multiline is used.
let args = &["-U", "--no-mmap", r"^baz", "test"];
eqnice!("baz\n", dir.command().args(args).stdout());
let args = &["-U", "--mmap", r"^baz", "test"];
eqnice!("baz\n", dir.command().args(args).stdout());
// But when (?-m) is disabled, or when \A is used, then there should be no
// matches that aren't anchored to the beginning of the file.
let args = &["-U", "--no-mmap", r"(?-m)^baz", "test"];
dir.command().args(args).assert_err();
let args = &["-U", "--mmap", r"(?-m)^baz", "test"];
dir.command().args(args).assert_err();
let args = &["-U", "--no-mmap", r"\Abaz", "test"];
dir.command().args(args).assert_err();
let args = &["-U", "--mmap", r"\Abaz", "test"];
dir.command().args(args).assert_err();
});
// See: https://github.com/BurntSushi/ripgrep/issues/1891
rgtest!(r1891, |dir: Dir, mut cmd: TestCommand| {
dir.create("test", "\n##\n");
// N.B. We use -o here to force the issue to occur, which seems to only
// happen when each match needs to be detected.
2023-10-09 18:23:36 -04:00
eqnice!("1:\n2:\n2:\n2:\n", cmd.args(&["-won", "", "test"]).stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/2095
rgtest!(r2095, |dir: Dir, mut cmd: TestCommand| {
dir.create(
"test",
"#!/usr/bin/env bash
zero=one
a=one
if true; then
a=(
a
b
c
)
true
fi
a=two
b=one
});
",
);
cmd.args(&[
"--line-number",
"--multiline",
"--only-matching",
"--replace",
"${value}",
r"^(?P<indent>\s*)a=(?P<value>(?ms:[(].*?[)])|.*?)$",
"test",
]);
let expected = "4:one
8:(
9: a
10: b
11: c
12: )
15:two
";
eqnice!(expected, cmd.stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/2198
rgtest!(r2198, |dir: Dir, mut cmd: TestCommand| {
dir.create(".ignore", "a");
dir.create(".rgignore", "b");
dir.create("a", "");
dir.create("b", "");
dir.create("c", "");
cmd.arg("--files").arg("--sort").arg("path");
eqnice!("c\n", cmd.stdout());
eqnice!("a\nb\nc\n", cmd.arg("--no-ignore-dot").stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/2208
rgtest!(r2208, |dir: Dir, mut cmd: TestCommand| {
dir.create("test", "# Compile requirements.txt files from all found or specified requirements.in files (compile).
# Use -h to include hashes, -u dep1,dep2... to upgrade specific dependencies, and -U to upgrade all.
pipc () { # [-h] [-U|-u <pkgspec>[,<pkgspec>...]] [<reqs-in>...] [-- <pip-compile-arg>...]
emulate -L zsh
unset REPLY
if [[ $1 == --help ]] { zpy $0; return }
[[ $ZPY_PROCS ]] || return
local gen_hashes upgrade upgrade_csv
while [[ $1 == -[hUu] ]] {
if [[ $1 == -h ]] { gen_hashes=--generate-hashes; shift }
if [[ $1 == -U ]] { upgrade=1; shift }
if [[ $1 == -u ]] { upgrade=1; upgrade_csv=$2; shift 2 }
}
}
");
cmd.args(&[
"-N",
"-U",
"-r", "$usage",
r#"^(?P<predoc>\n?(# .*\n)*)(alias (?P<aname>pipc)="[^"]+"|(?P<fname>pipc) \(\) \{)( #(?P<usage> .+))?"#,
"test",
]);
let expected = " [-h] [-U|-u <pkgspec>[,<pkgspec>...]] [<reqs-in>...] [-- <pip-compile-arg>...]\n";
eqnice!(expected, cmd.stdout());
});
// See: https://github.com/BurntSushi/ripgrep/issues/2236
rgtest!(r2236, |dir: Dir, mut cmd: TestCommand| {
dir.create(".ignore", r"foo\/");
dir.create_dir("foo");
dir.create("foo/bar", "test\n");
cmd.args(&["test"]).assert_err();
});
// See: https://github.com/BurntSushi/ripgrep/issues/2480
rgtest!(r2480, |dir: Dir, mut cmd: TestCommand| {
dir.create("file", "FooBar\n");
// no regression in empty pattern behavior
cmd.args(&["-e", "", "file"]);
eqnice!("FooBar\n", cmd.stdout());
// no regression in single pattern behavior
let mut cmd = dir.command();
cmd.args(&["-e", ")(", "file"]);
eqnice!("FooBar\n", cmd.stdout());
// no regression in multiple patterns behavior
let mut cmd = dir.command();
cmd.args(&["--only-matching", "-e", "Foo", "-e", "Bar", "file"]);
eqnice!("Foo\nBar\n", cmd.stdout());
// no regression in capture groups behavior
let mut cmd = dir.command();
cmd.args(&["-e", "Fo(oB)a(r)", "--replace", "${0}_${1}_${2}${3}", "file"]);
eqnice!("FooBar_oB_r\n", cmd.stdout()); // note: ${3} expected to be empty
// flag does not leak into next pattern on match
let mut cmd = dir.command();
cmd.args(&["--only-matching", "-e", "(?i)foo", "-e", "bar", "file"]);
eqnice!("Foo\n", cmd.stdout());
// flag does not leak into next pattern on mismatch
let mut cmd = dir.command();
cmd.args(&["--only-matching", "-e", "(?i)notfoo", "-e", "bar", "file"]);
cmd.assert_err();
});
// See: https://github.com/BurntSushi/ripgrep/issues/2574
rgtest!(r2574, |dir: Dir, mut cmd: TestCommand| {
dir.create("haystack", "some.domain.com\nsome.domain.com/x\n");
let got = cmd
.args(&[
"--no-filename",
"--no-unicode",
"-w",
"-o",
r"(\w+\.)*domain\.(\w+)",
])
.stdout();
eqnice!("some.domain.com\nsome.domain.com\n", got);
});