2019-01-19 10:15:56 -05:00
|
|
|
use crate::hay::SHERLOCK;
|
2020-02-17 18:08:47 -05:00
|
|
|
use crate::util::{sort_lines, Dir, TestCommand};
|
2018-08-06 20:11:58 -04:00
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/16
|
|
|
|
|
rgtest!(r16, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create_dir(".git");
|
|
|
|
|
dir.create(".gitignore", "ghi/");
|
|
|
|
|
dir.create_dir("ghi");
|
|
|
|
|
dir.create_dir("def/ghi");
|
|
|
|
|
dir.create("ghi/toplevel.txt", "xyz");
|
|
|
|
|
dir.create("def/ghi/subdir.txt", "xyz");
|
|
|
|
|
|
|
|
|
|
cmd.arg("xyz").assert_err();
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/25
|
|
|
|
|
rgtest!(r25, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create_dir(".git");
|
|
|
|
|
dir.create(".gitignore", "/llvm/");
|
|
|
|
|
dir.create_dir("src/llvm");
|
|
|
|
|
dir.create("src/llvm/foo", "test");
|
|
|
|
|
|
|
|
|
|
cmd.arg("test");
|
|
|
|
|
eqnice!("src/llvm/foo:test\n", cmd.stdout());
|
|
|
|
|
|
|
|
|
|
cmd.current_dir(dir.path().join("src"));
|
|
|
|
|
eqnice!("llvm/foo:test\n", cmd.stdout());
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/30
|
|
|
|
|
rgtest!(r30, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create(".gitignore", "vendor/**\n!vendor/manifest");
|
|
|
|
|
dir.create_dir("vendor");
|
|
|
|
|
dir.create("vendor/manifest", "test");
|
|
|
|
|
|
|
|
|
|
eqnice!("vendor/manifest:test\n", cmd.arg("test").stdout());
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/49
|
|
|
|
|
rgtest!(r49, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create(".gitignore", "foo/bar");
|
|
|
|
|
dir.create_dir("test/foo/bar");
|
|
|
|
|
dir.create("test/foo/bar/baz", "test");
|
|
|
|
|
|
|
|
|
|
cmd.arg("xyz").assert_err();
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/50
|
|
|
|
|
rgtest!(r50, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create(".gitignore", "XXX/YYY/");
|
|
|
|
|
dir.create_dir("abc/def/XXX/YYY");
|
|
|
|
|
dir.create_dir("ghi/XXX/YYY");
|
|
|
|
|
dir.create("abc/def/XXX/YYY/bar", "test");
|
|
|
|
|
dir.create("ghi/XXX/YYY/bar", "test");
|
|
|
|
|
|
|
|
|
|
cmd.arg("xyz").assert_err();
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/64
|
|
|
|
|
rgtest!(r64, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create_dir("dir");
|
|
|
|
|
dir.create_dir("foo");
|
|
|
|
|
dir.create("dir/abc", "");
|
|
|
|
|
dir.create("foo/abc", "");
|
|
|
|
|
|
|
|
|
|
eqnice!("foo/abc\n", cmd.arg("--files").arg("foo").stdout());
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/65
|
|
|
|
|
rgtest!(r65, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create_dir(".git");
|
|
|
|
|
dir.create(".gitignore", "a/");
|
|
|
|
|
dir.create_dir("a");
|
|
|
|
|
dir.create("a/foo", "xyz");
|
|
|
|
|
dir.create("a/bar", "xyz");
|
|
|
|
|
|
|
|
|
|
cmd.arg("xyz").assert_err();
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/67
|
|
|
|
|
rgtest!(r67, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create_dir(".git");
|
|
|
|
|
dir.create(".gitignore", "/*\n!/dir");
|
|
|
|
|
dir.create_dir("dir");
|
|
|
|
|
dir.create_dir("foo");
|
|
|
|
|
dir.create("foo/bar", "test");
|
|
|
|
|
dir.create("dir/bar", "test");
|
|
|
|
|
|
|
|
|
|
eqnice!("dir/bar:test\n", cmd.arg("test").stdout());
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/87
|
|
|
|
|
rgtest!(r87, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create_dir(".git");
|
|
|
|
|
dir.create(".gitignore", "foo\n**no-vcs**");
|
|
|
|
|
dir.create("foo", "test");
|
|
|
|
|
|
|
|
|
|
cmd.arg("test").assert_err();
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/90
|
|
|
|
|
rgtest!(r90, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create_dir(".git");
|
|
|
|
|
dir.create(".gitignore", "!.foo");
|
|
|
|
|
dir.create(".foo", "test");
|
|
|
|
|
|
|
|
|
|
eqnice!(".foo:test\n", cmd.arg("test").stdout());
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/93
|
|
|
|
|
rgtest!(r93, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create("foo", "192.168.1.1");
|
|
|
|
|
|
|
|
|
|
eqnice!("foo:192.168.1.1\n", cmd.arg(r"(\d{1,3}\.){3}\d{1,3}").stdout());
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/99
|
|
|
|
|
rgtest!(r99, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create("foo1", "test");
|
|
|
|
|
dir.create("foo2", "zzz");
|
|
|
|
|
dir.create("bar", "test");
|
|
|
|
|
|
|
|
|
|
eqnice!(
|
|
|
|
|
sort_lines("bar\ntest\n\nfoo1\ntest\n"),
|
|
|
|
|
sort_lines(&cmd.arg("-j1").arg("--heading").arg("test").stdout())
|
|
|
|
|
);
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/105
|
|
|
|
|
rgtest!(r105_part1, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create("foo", "zztest");
|
|
|
|
|
|
|
|
|
|
eqnice!("foo:1:3:zztest\n", cmd.arg("--vimgrep").arg("test").stdout());
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/105
|
|
|
|
|
rgtest!(r105_part2, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create("foo", "zztest");
|
|
|
|
|
|
|
|
|
|
eqnice!("foo:1:3:zztest\n", cmd.arg("--column").arg("test").stdout());
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/127
|
|
|
|
|
rgtest!(r127, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
// Set up a directory hierarchy like this:
|
|
|
|
|
//
|
|
|
|
|
// .gitignore
|
|
|
|
|
// foo/
|
|
|
|
|
// sherlock
|
|
|
|
|
// watson
|
|
|
|
|
//
|
|
|
|
|
// Where `.gitignore` contains `foo/sherlock`.
|
|
|
|
|
//
|
|
|
|
|
// ripgrep should ignore 'foo/sherlock' giving us results only from
|
|
|
|
|
// 'foo/watson' but on Windows ripgrep will include both 'foo/sherlock' and
|
|
|
|
|
// 'foo/watson' in the search results.
|
|
|
|
|
dir.create_dir(".git");
|
|
|
|
|
dir.create(".gitignore", "foo/sherlock\n");
|
|
|
|
|
dir.create_dir("foo");
|
|
|
|
|
dir.create("foo/sherlock", SHERLOCK);
|
|
|
|
|
dir.create("foo/watson", SHERLOCK);
|
|
|
|
|
|
|
|
|
|
let expected = "\
|
|
|
|
|
foo/watson:For the Doctor Watsons of this world, as opposed to the Sherlock
|
|
|
|
|
foo/watson:be, to a very large extent, the result of luck. Sherlock Holmes
|
|
|
|
|
";
|
|
|
|
|
assert_eq!(expected, cmd.arg("Sherlock").stdout());
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/128
|
|
|
|
|
rgtest!(r128, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create_bytes("foo", b"01234567\x0b\n\x0b\n\x0b\n\x0b\nx");
|
|
|
|
|
|
|
|
|
|
eqnice!("foo:5:x\n", cmd.arg("-n").arg("x").stdout());
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/131
|
|
|
|
|
//
|
|
|
|
|
// TODO(burntsushi): Darwin doesn't like this test for some reason. Probably
|
|
|
|
|
// due to the weird file path.
|
|
|
|
|
#[cfg(not(target_os = "macos"))]
|
|
|
|
|
rgtest!(r131, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create_dir(".git");
|
|
|
|
|
dir.create(".gitignore", "TopÑapa");
|
|
|
|
|
dir.create("TopÑapa", "test");
|
|
|
|
|
|
|
|
|
|
cmd.arg("test").assert_err();
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/137
|
|
|
|
|
//
|
|
|
|
|
// TODO(burntsushi): Figure out how to make this test work on Windows. Right
|
|
|
|
|
// now it gives "access denied" errors when trying to create a file symlink.
|
|
|
|
|
// For now, disable test on Windows.
|
|
|
|
|
#[cfg(not(windows))]
|
|
|
|
|
rgtest!(r137, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create("sherlock", SHERLOCK);
|
|
|
|
|
dir.link_file("sherlock", "sym1");
|
|
|
|
|
dir.link_file("sherlock", "sym2");
|
|
|
|
|
|
|
|
|
|
let expected = "\
|
|
|
|
|
./sherlock:For the Doctor Watsons of this world, as opposed to the Sherlock
|
|
|
|
|
./sherlock:be, to a very large extent, the result of luck. Sherlock Holmes
|
|
|
|
|
sym1:For the Doctor Watsons of this world, as opposed to the Sherlock
|
|
|
|
|
sym1:be, to a very large extent, the result of luck. Sherlock Holmes
|
|
|
|
|
sym2:For the Doctor Watsons of this world, as opposed to the Sherlock
|
|
|
|
|
sym2:be, to a very large extent, the result of luck. Sherlock Holmes
|
|
|
|
|
";
|
|
|
|
|
cmd.arg("-j1").arg("Sherlock").arg("./").arg("sym1").arg("sym2");
|
|
|
|
|
eqnice!(expected, cmd.stdout());
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/156
|
|
|
|
|
rgtest!(r156, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
let expected = r#"#parse('widgets/foo_bar_macros.vm')
|
|
|
|
|
#parse ( 'widgets/mobile/foo_bar_macros.vm' )
|
|
|
|
|
#parse ("widgets/foobarhiddenformfields.vm")
|
|
|
|
|
#parse ( "widgets/foo_bar_legal.vm" )
|
|
|
|
|
#include( 'widgets/foo_bar_tips.vm' )
|
|
|
|
|
#include('widgets/mobile/foo_bar_macros.vm')
|
|
|
|
|
#include ("widgets/mobile/foo_bar_resetpw.vm")
|
|
|
|
|
#parse('widgets/foo-bar-macros.vm')
|
|
|
|
|
#parse ( 'widgets/mobile/foo-bar-macros.vm' )
|
|
|
|
|
#parse ("widgets/foo-bar-hiddenformfields.vm")
|
|
|
|
|
#parse ( "widgets/foo-bar-legal.vm" )
|
|
|
|
|
#include( 'widgets/foo-bar-tips.vm' )
|
|
|
|
|
#include('widgets/mobile/foo-bar-macros.vm')
|
|
|
|
|
#include ("widgets/mobile/foo-bar-resetpw.vm")
|
|
|
|
|
"#;
|
|
|
|
|
dir.create("testcase.txt", expected);
|
|
|
|
|
|
|
|
|
|
cmd.arg("-N");
|
|
|
|
|
cmd.arg(r#"#(?:parse|include)\s*\(\s*(?:"|')[./A-Za-z_-]+(?:"|')"#);
|
|
|
|
|
cmd.arg("testcase.txt");
|
|
|
|
|
eqnice!(expected, cmd.stdout());
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/184
|
|
|
|
|
rgtest!(r184, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create(".gitignore", ".*");
|
|
|
|
|
dir.create_dir("foo/bar");
|
|
|
|
|
dir.create("foo/bar/baz", "test");
|
|
|
|
|
|
|
|
|
|
cmd.arg("test");
|
|
|
|
|
eqnice!("foo/bar/baz:test\n", cmd.stdout());
|
|
|
|
|
|
|
|
|
|
cmd.current_dir(dir.path().join("./foo/bar"));
|
|
|
|
|
eqnice!("baz:test\n", cmd.stdout());
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/199
|
|
|
|
|
rgtest!(r199, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create("foo", "tEsT");
|
|
|
|
|
|
|
|
|
|
eqnice!("foo:tEsT\n", cmd.arg("--smart-case").arg(r"\btest\b").stdout());
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/206
|
|
|
|
|
rgtest!(r206, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create_dir("foo");
|
|
|
|
|
dir.create("foo/bar.txt", "test");
|
|
|
|
|
|
|
|
|
|
cmd.arg("test").arg("-g").arg("*.txt");
|
|
|
|
|
eqnice!("foo/bar.txt:test\n", cmd.stdout());
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/210
|
|
|
|
|
#[cfg(unix)]
|
|
|
|
|
rgtest!(r210, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
use std::ffi::OsStr;
|
|
|
|
|
use std::os::unix::ffi::OsStrExt;
|
|
|
|
|
|
|
|
|
|
let badutf8 = OsStr::from_bytes(&b"foo\xffbar"[..]);
|
|
|
|
|
|
|
|
|
|
// APFS does not support creating files with invalid UTF-8 bytes.
|
|
|
|
|
// https://github.com/BurntSushi/ripgrep/issues/559
|
|
|
|
|
if dir.try_create(badutf8, "test").is_ok() {
|
|
|
|
|
cmd.arg("-H").arg("test").arg(badutf8);
|
|
|
|
|
assert_eq!(b"foo\xffbar:test\n".to_vec(), cmd.output().stdout);
|
|
|
|
|
}
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/228
|
|
|
|
|
rgtest!(r228, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create_dir("foo");
|
|
|
|
|
|
|
|
|
|
cmd.arg("--ignore-file").arg("foo").arg("test").assert_err();
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/229
|
|
|
|
|
rgtest!(r229, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create("foo", "economie");
|
|
|
|
|
|
|
|
|
|
cmd.arg("-S").arg("[E]conomie").assert_err();
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/251
|
|
|
|
|
rgtest!(r251, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create("foo", "привет\nПривет\nПрИвЕт");
|
|
|
|
|
|
|
|
|
|
let expected = "foo:привет\nfoo:Привет\nfoo:ПрИвЕт\n";
|
|
|
|
|
eqnice!(expected, cmd.arg("-i").arg("привет").stdout());
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/256
|
|
|
|
|
#[cfg(not(windows))]
|
|
|
|
|
rgtest!(r256, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create_dir("bar");
|
|
|
|
|
dir.create("bar/baz", "test");
|
|
|
|
|
dir.link_dir("bar", "foo");
|
|
|
|
|
|
|
|
|
|
eqnice!("foo/baz:test\n", cmd.arg("test").arg("foo").stdout());
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/256
|
|
|
|
|
#[cfg(not(windows))]
|
|
|
|
|
rgtest!(r256_j1, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create_dir("bar");
|
|
|
|
|
dir.create("bar/baz", "test");
|
|
|
|
|
dir.link_dir("bar", "foo");
|
|
|
|
|
|
|
|
|
|
eqnice!("foo/baz:test\n", cmd.arg("-j1").arg("test").arg("foo").stdout());
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/270
|
|
|
|
|
rgtest!(r270, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create("foo", "-test");
|
|
|
|
|
|
|
|
|
|
cmd.arg("-e").arg("-test");
|
|
|
|
|
eqnice!("foo:-test\n", cmd.stdout());
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/279
|
|
|
|
|
rgtest!(r279, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create("foo", "test");
|
|
|
|
|
|
|
|
|
|
eqnice!("", cmd.arg("-q").arg("test").stdout());
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/391
|
|
|
|
|
rgtest!(r391, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create_dir(".git");
|
|
|
|
|
dir.create("lock", "");
|
|
|
|
|
dir.create("bar.py", "");
|
|
|
|
|
dir.create(".git/packed-refs", "");
|
|
|
|
|
dir.create(".git/description", "");
|
|
|
|
|
|
|
|
|
|
cmd.args(&[
|
2020-02-17 18:08:47 -05:00
|
|
|
"--no-ignore",
|
|
|
|
|
"--hidden",
|
|
|
|
|
"--follow",
|
|
|
|
|
"--files",
|
2018-08-06 20:11:58 -04:00
|
|
|
"--glob",
|
|
|
|
|
"!{.git,node_modules,plugged}/**",
|
|
|
|
|
"--glob",
|
|
|
|
|
"*.{js,json,php,md,styl,scss,sass,pug,html,config,py,cpp,c,go,hs}",
|
|
|
|
|
]);
|
|
|
|
|
eqnice!("bar.py\n", cmd.stdout());
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/405
|
|
|
|
|
rgtest!(r405, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create_dir("foo/bar");
|
|
|
|
|
dir.create_dir("bar/foo");
|
|
|
|
|
dir.create("foo/bar/file1.txt", "test");
|
|
|
|
|
dir.create("bar/foo/file2.txt", "test");
|
|
|
|
|
|
|
|
|
|
cmd.arg("-g").arg("!/foo/**").arg("test");
|
|
|
|
|
eqnice!("bar/foo/file2.txt:test\n", cmd.stdout());
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/428
|
|
|
|
|
#[cfg(not(windows))]
|
|
|
|
|
rgtest!(r428_color_context_path, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create("sherlock", "foo\nbar");
|
|
|
|
|
cmd.args(&[
|
2020-02-17 18:08:47 -05:00
|
|
|
"-A1",
|
|
|
|
|
"-H",
|
|
|
|
|
"--no-heading",
|
|
|
|
|
"-N",
|
|
|
|
|
"--colors=match:none",
|
|
|
|
|
"--color=always",
|
2023-07-08 00:56:50 +02:00
|
|
|
"--hyperlink-format=",
|
2018-08-06 20:11:58 -04:00
|
|
|
"foo",
|
|
|
|
|
]);
|
|
|
|
|
|
|
|
|
|
let expected = format!(
|
|
|
|
|
"{colored_path}:foo\n{colored_path}-bar\n",
|
2020-02-17 18:08:47 -05:00
|
|
|
colored_path =
|
2018-08-06 20:11:58 -04:00
|
|
|
"\x1b\x5b\x30\x6d\x1b\x5b\x33\x35\x6dsherlock\x1b\x5b\x30\x6d"
|
|
|
|
|
);
|
|
|
|
|
eqnice!(expected, cmd.stdout());
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/428
|
cli: print warning if nothing was searched
This was once part of ripgrep, but at some point, was unintentionally
removed. The value of this warning is that since ripgrep tries to be
"smart" by default, it can be surprising if it doesn't search certain
things. This warning covers the case when ripgrep searches *nothing*,
which happens somewhat more frequently than you might expect. e.g., If
you're searching within an ignore directory.
Note that for now, we only print this message when the user has not
supplied any explicit paths. It's not clear that we want to print this
otherwise, and in particular, it seems that the message shows up too
eagerly. e.g., 'rg foo does-not-exist' will both print an error about
'does-not-exist' not existing, *and* the message about no files being
searched, which seems annoying in this case. We can always refine this
logic later.
Fixes #1404, Closes #1762
2020-12-14 23:59:55 -08:00
|
|
|
rgtest!(r428_unrecognized_style, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create("file.txt", "Sherlock");
|
|
|
|
|
|
2018-08-06 20:11:58 -04:00
|
|
|
cmd.arg("--colors=match:style:").arg("Sherlock");
|
|
|
|
|
cmd.assert_err();
|
|
|
|
|
|
|
|
|
|
let output = cmd.cmd().output().unwrap();
|
|
|
|
|
let stderr = String::from_utf8_lossy(&output.stderr);
|
|
|
|
|
let expected = "\
|
cli: replace clap with lexopt and supporting code
ripgrep began it's life with docopt for argument parsing. Then it moved
to Clap and stayed there for a number of years. Clap has served ripgrep
well, and it probably could continue to serve ripgrep well, but I ended
up deciding to move off of it.
Why?
The first time I had the thought of moving off of Clap was during the
2->3->4 transition. I thought the 3.x and 4.x releases were great, but
for me, it ended up moving a little too quickly. Since the release of
4.x was telegraphed around when 3.x came out, I decided to just hold off
and wait to migrate to 4.x instead of doing a 3.x migration followed
shortly by another 4.x migration. Of course, I just never ended up doing
the migration at all. I never got around to it and there just wasn't a
compelling reason for me to upgrade. While I never investigated it, I
saw an upgrade as a non-trivial amount of work in part because I didn't
encapsulate the usage of Clap enough.
The above is just what got me started thinking about it. It wasn't
enough to get me to move off of it on its own. What ended up pushing me
over the edge was a combination of factors:
* As mentioned above, I didn't want to run on the migration treadmill.
This has proven to not be much of an issue, but at the time of the
2->3->4 releases, I didn't know how long Clap 4.x would be out before a
5.x would come out.
* The release of lexopt[1] caught my eye. IMO, that crate demonstrates
exactly how something new can arrive on the scene and just thoroughly
solve a problem minimalistically. It has the docs, the reasoning, the
simple API, the tests and good judgment. It gets all the weird corner
cases right that Clap also gets right (and is part of why I was
originally attracted to Clap).
* I have an overall desire to reduce the size of my dependency tree. In
part because a smaller dependency tree tends to correlate with better
compile times, but also in part because it reduces my reliance and trust
on others. It lets me be the "master" of ripgrep's destiny by reducing
the amount of behavior that is the result of someone else's decision
(whether good or bad).
* I perceived that Clap solves a more general problem than what I
actually need solved. Despite the vast number of flags that ripgrep has,
its requirements are actually pretty simple. We just need simple
switches and flags that support one value. No multi-value flags. No
sub-commands. And probably a lot of other functionality that Clap has
that makes it so flexible for so many different use cases. (I'm being
hand wavy on the last point.)
With all that said, perhaps most importantly, the future of ripgrep
possibly demands a more flexible CLI argument parser. In today's world,
I would really like, for example, flags like `--type` and `--type-not`
to be able to accumulate their repeated values into a single sequence
while respecting the order they appear on the CLI. For example, prior
to this migration, `rg regex-automata -Tlock -ttoml` would not return
results in `Cargo.lock` in this repository because the `-Tlock` always
took priority even though `-ttoml` appeared after it. But with this
migration, `-ttoml` now correctly overrides `-Tlock`. We would like to
do similar things for `-g/--glob` and `--iglob` and potentially even
now introduce a `-G/--glob-not` flag instead of requiring users to use
`!` to negate a glob. (Which I had done originally to work-around this
problem.) And some day, I'd like to add some kind of boolean matching to
ripgrep perhaps similar to how `git grep` does it. (Although I haven't
thought too carefully on a design yet.) In order to do that, I perceive
it would be difficult to implement correctly in Clap.
I believe that this last point is possible to implement correctly in
Clap 2.x, although it is awkward to do so. I have not looked closely
enough at the Clap 4.x API to know whether it's still possible there. In
any case, these were enough reasons to move off of Clap and own more of
the argument parsing process myself.
This did require a few things:
* I had to write my own logic for how arguments are combined into one
single state object. Of course, I wanted this. This was part of the
upside. But it's still code I didn't have to write for Clap.
* I had to write my own shell completion generator.
* I had to write my own `-h/--help` output generator.
* I also had to write my own man page generator. Well, I had to do this
with Clap 2.x too, although my understanding is that Clap 4.x supports
this. With that said, without having tried it, my guess is that I
probably wouldn't have liked the output it generated because I
ultimately had to write most of the roff by hand myself to get the man
page I wanted. (This also had the benefit of dropping the build
dependency on asciidoc/asciidoctor.)
While this is definitely a fair bit of extra work, it overall only cost
me a couple days. IMO, that's a good trade off given that this code is
unlikely to change again in any substantial way. And it should also
allow for more flexible semantics going forward.
Fixes #884, Fixes #1648, Fixes #1701, Fixes #1814, Fixes #1966
[1]: https://docs.rs/lexopt/0.3.0/lexopt/index.html
2023-10-16 18:05:39 -04:00
|
|
|
error parsing flag --colors: \
|
2018-08-06 20:11:58 -04:00
|
|
|
unrecognized style attribute ''. Choose from: nobold, bold, nointense, \
|
|
|
|
|
intense, nounderline, underline.
|
|
|
|
|
";
|
|
|
|
|
eqnice!(expected, stderr);
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/451
|
|
|
|
|
rgtest!(r451_only_matching_as_in_issue, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create("digits.txt", "1 2 3\n");
|
|
|
|
|
cmd.arg("--only-matching").arg(r"[0-9]+").arg("digits.txt");
|
|
|
|
|
|
|
|
|
|
let expected = "\
|
|
|
|
|
1
|
|
|
|
|
2
|
|
|
|
|
3
|
|
|
|
|
";
|
|
|
|
|
eqnice!(expected, cmd.stdout());
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/451
|
|
|
|
|
rgtest!(r451_only_matching, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create("digits.txt", "1 2 3\n123\n");
|
2020-02-17 18:08:47 -05:00
|
|
|
cmd.args(&["--only-matching", "--column", r"[0-9]", "digits.txt"]);
|
2018-08-06 20:11:58 -04:00
|
|
|
|
|
|
|
|
let expected = "\
|
|
|
|
|
1:1:1
|
|
|
|
|
1:3:2
|
|
|
|
|
1:5:3
|
|
|
|
|
2:1:1
|
|
|
|
|
2:2:2
|
|
|
|
|
2:3:3
|
|
|
|
|
";
|
|
|
|
|
eqnice!(expected, cmd.stdout());
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/483
|
|
|
|
|
rgtest!(r483_matching_no_stdout, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create("file.py", "");
|
|
|
|
|
cmd.arg("--quiet").arg("--files").arg("--glob").arg("*.py");
|
|
|
|
|
eqnice!("", cmd.stdout());
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/483
|
|
|
|
|
rgtest!(r483_non_matching_exit_code, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create("file.rs", "");
|
|
|
|
|
cmd.arg("--quiet").arg("--files").arg("--glob").arg("*.py");
|
|
|
|
|
cmd.assert_err();
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/493
|
|
|
|
|
rgtest!(r493, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create("input.txt", "peshwaship 're seminomata");
|
|
|
|
|
|
|
|
|
|
cmd.arg("-o").arg(r"\b 're \b").arg("input.txt");
|
|
|
|
|
assert_eq!(" 're \n", cmd.stdout());
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/506
|
|
|
|
|
rgtest!(r506_word_not_parenthesized, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create("wb.txt", "min minimum amin\nmax maximum amax");
|
|
|
|
|
cmd.arg("-w").arg("-o").arg("min|max").arg("wb.txt");
|
|
|
|
|
eqnice!("min\nmax\n", cmd.stdout());
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/553
|
|
|
|
|
rgtest!(r553_switch, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create("sherlock", SHERLOCK);
|
|
|
|
|
|
|
|
|
|
let expected = "\
|
|
|
|
|
sherlock:For the Doctor Watsons of this world, as opposed to the Sherlock
|
|
|
|
|
sherlock:be, to a very large extent, the result of luck. Sherlock Holmes
|
|
|
|
|
";
|
|
|
|
|
cmd.arg("-i").arg("sherlock");
|
|
|
|
|
eqnice!(expected, cmd.stdout());
|
|
|
|
|
|
|
|
|
|
// Repeat the `i` flag to make sure everything still works.
|
|
|
|
|
eqnice!(expected, cmd.arg("-i").stdout());
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
rgtest!(r553_flag, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create("sherlock", SHERLOCK);
|
|
|
|
|
|
|
|
|
|
let expected = "\
|
|
|
|
|
For the Doctor Watsons of this world, as opposed to the Sherlock
|
|
|
|
|
Holmeses, success in the province of detective work must always
|
|
|
|
|
--
|
|
|
|
|
but Doctor Watson has to have it taken out for him and dusted,
|
|
|
|
|
and exhibited clearly, with a label attached.
|
|
|
|
|
";
|
|
|
|
|
cmd.arg("-C").arg("1").arg(r"world|attached").arg("sherlock");
|
|
|
|
|
eqnice!(expected, cmd.stdout());
|
|
|
|
|
|
|
|
|
|
let expected = "\
|
|
|
|
|
For the Doctor Watsons of this world, as opposed to the Sherlock
|
|
|
|
|
and exhibited clearly, with a label attached.
|
|
|
|
|
";
|
|
|
|
|
eqnice!(expected, cmd.arg("-C").arg("0").stdout());
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/568
|
|
|
|
|
rgtest!(r568_leading_hyphen_option_args, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create("file", "foo bar -baz\n");
|
|
|
|
|
cmd.arg("-e-baz").arg("-e").arg("-baz").arg("file");
|
|
|
|
|
eqnice!("foo bar -baz\n", cmd.stdout());
|
|
|
|
|
|
|
|
|
|
let mut cmd = dir.command();
|
|
|
|
|
cmd.arg("-rni").arg("bar").arg("file");
|
|
|
|
|
eqnice!("foo ni -baz\n", cmd.stdout());
|
|
|
|
|
|
|
|
|
|
let mut cmd = dir.command();
|
|
|
|
|
cmd.arg("-r").arg("-n").arg("-i").arg("bar").arg("file");
|
|
|
|
|
eqnice!("foo -n -baz\n", cmd.stdout());
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/599
|
|
|
|
|
//
|
|
|
|
|
// This test used to check that we emitted color escape sequences even for
|
|
|
|
|
// empty matches, but with the addition of the JSON output format, clients no
|
|
|
|
|
// longer need to rely on escape sequences to parse matches. Therefore, we no
|
|
|
|
|
// longer emit useless escape sequences.
|
|
|
|
|
rgtest!(r599, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create("input.txt", "\n\ntest\n");
|
|
|
|
|
cmd.args(&[
|
2020-02-17 18:08:47 -05:00
|
|
|
"--color",
|
|
|
|
|
"ansi",
|
|
|
|
|
"--colors",
|
|
|
|
|
"path:none",
|
|
|
|
|
"--colors",
|
|
|
|
|
"line:none",
|
|
|
|
|
"--colors",
|
|
|
|
|
"match:fg:red",
|
|
|
|
|
"--colors",
|
|
|
|
|
"match:style:nobold",
|
2018-08-06 20:11:58 -04:00
|
|
|
"--line-number",
|
|
|
|
|
r"^$",
|
|
|
|
|
"input.txt",
|
|
|
|
|
]);
|
|
|
|
|
|
|
|
|
|
let expected = "\
|
|
|
|
|
[0m1[0m:
|
|
|
|
|
[0m2[0m:
|
|
|
|
|
";
|
|
|
|
|
eqnice_repr!(expected, cmd.stdout());
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/693
|
|
|
|
|
rgtest!(r693_context_in_contextless_mode, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create("foo", "xyz\n");
|
|
|
|
|
dir.create("bar", "xyz\n");
|
|
|
|
|
|
|
|
|
|
cmd.arg("-C1").arg("-c").arg("--sort-files").arg("xyz");
|
|
|
|
|
eqnice!("bar:1\nfoo:1\n", cmd.stdout());
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/807
|
|
|
|
|
rgtest!(r807, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create_dir(".git");
|
|
|
|
|
dir.create(".gitignore", ".a/b");
|
|
|
|
|
dir.create_dir(".a/b");
|
|
|
|
|
dir.create_dir(".a/c");
|
|
|
|
|
dir.create(".a/b/file", "test");
|
|
|
|
|
dir.create(".a/c/file", "test");
|
|
|
|
|
|
|
|
|
|
eqnice!(".a/c/file:test\n", cmd.arg("--hidden").arg("test").stdout());
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/900
|
|
|
|
|
rgtest!(r900, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create("sherlock", SHERLOCK);
|
|
|
|
|
dir.create("pat", "");
|
|
|
|
|
|
|
|
|
|
cmd.arg("-fpat").arg("sherlock").assert_err();
|
|
|
|
|
});
|
2018-09-24 19:24:33 -04:00
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/1064
|
|
|
|
|
rgtest!(r1064, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create("input", "abc");
|
|
|
|
|
eqnice!("input:abc\n", cmd.arg("a(.*c)").stdout());
|
|
|
|
|
});
|
2019-01-20 17:32:34 -08:00
|
|
|
|
globset: permit ** to appear anywhere
Previously, `man gitignore` specified that `**` was invalid unless it
was used in one of a few specific circumstances, i.e., `**`, `a/**`,
`**/b` or `a/**/b`. That is, `**` always had to be surrounded by either
a path separator or the beginning/end of the pattern.
It turns out that git itself has treated `**` outside the above contexts
as valid for quite a while, so there was an inconsistency between the
spec `man gitignore` and the implementation, and it wasn't clear which
was actually correct.
@okdana filed a bug against git[1] and got this fixed. The spec was wrong,
which has now been fixed [2] and updated[2].
This commit brings ripgrep in line with git and treats `**` outside of
the above contexts as two consecutive `*` patterns. We deprecate the
`InvalidRecursive` error since it is no longer used.
Fixes #373, Fixes #1098
[1] - https://public-inbox.org/git/C16A9F17-0375-42F9-90A9-A92C9F3D8BBA@dana.is
[2] - https://github.com/git/git/commit/627186d0206dcb219c43f8e6670b4487802a4921
[3] - https://git-scm.com/docs/gitignore
2019-01-23 19:46:15 -05:00
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/1174
|
|
|
|
|
rgtest!(r1098, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create_dir(".git");
|
|
|
|
|
dir.create(".gitignore", "a**b");
|
|
|
|
|
dir.create("afoob", "test");
|
|
|
|
|
cmd.arg("test").assert_err();
|
|
|
|
|
});
|
|
|
|
|
|
2018-12-01 13:31:33 +01:00
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/1130
|
|
|
|
|
rgtest!(r1130, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create("foo", "test");
|
|
|
|
|
eqnice!(
|
|
|
|
|
"foo\n",
|
|
|
|
|
cmd.arg("--files-with-matches").arg("test").arg("foo").stdout()
|
|
|
|
|
);
|
|
|
|
|
|
|
|
|
|
let mut cmd = dir.command();
|
|
|
|
|
eqnice!(
|
|
|
|
|
"foo\n",
|
|
|
|
|
cmd.arg("--files-without-match").arg("nada").arg("foo").stdout()
|
|
|
|
|
);
|
|
|
|
|
});
|
|
|
|
|
|
2019-01-26 14:36:34 -05:00
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/1159
|
2019-01-26 15:42:55 -05:00
|
|
|
rgtest!(r1159_invalid_flag, |_: Dir, mut cmd: TestCommand| {
|
2019-01-26 14:36:34 -05:00
|
|
|
cmd.arg("--wat").assert_exit_code(2);
|
|
|
|
|
});
|
|
|
|
|
|
2019-01-26 15:42:55 -05:00
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/1159
|
|
|
|
|
rgtest!(r1159_exit_status, |dir: Dir, _: TestCommand| {
|
|
|
|
|
dir.create("foo", "test");
|
|
|
|
|
|
|
|
|
|
// search with a match gets 0 exit status.
|
|
|
|
|
let mut cmd = dir.command();
|
|
|
|
|
cmd.arg("test").assert_exit_code(0);
|
|
|
|
|
|
|
|
|
|
// search with --quiet and a match gets 0 exit status.
|
|
|
|
|
let mut cmd = dir.command();
|
|
|
|
|
cmd.arg("-q").arg("test").assert_exit_code(0);
|
|
|
|
|
|
|
|
|
|
// search with a match and an error gets 2 exit status.
|
|
|
|
|
let mut cmd = dir.command();
|
|
|
|
|
cmd.arg("test").arg("no-file").assert_exit_code(2);
|
|
|
|
|
|
|
|
|
|
// search with a match in --quiet mode and an error gets 0 exit status.
|
|
|
|
|
let mut cmd = dir.command();
|
|
|
|
|
cmd.arg("-q").arg("test").arg("foo").arg("no-file").assert_exit_code(0);
|
|
|
|
|
|
|
|
|
|
// search with no match gets 1 exit status.
|
|
|
|
|
let mut cmd = dir.command();
|
|
|
|
|
cmd.arg("nada").assert_exit_code(1);
|
|
|
|
|
|
|
|
|
|
// search with --quiet and no match gets 1 exit status.
|
|
|
|
|
let mut cmd = dir.command();
|
|
|
|
|
cmd.arg("-q").arg("nada").assert_exit_code(1);
|
|
|
|
|
|
|
|
|
|
// search with no match and an error gets 2 exit status.
|
|
|
|
|
let mut cmd = dir.command();
|
|
|
|
|
cmd.arg("nada").arg("no-file").assert_exit_code(2);
|
|
|
|
|
|
|
|
|
|
// search with no match in --quiet mode and an error gets 2 exit status.
|
|
|
|
|
let mut cmd = dir.command();
|
|
|
|
|
cmd.arg("-q").arg("nada").arg("foo").arg("no-file").assert_exit_code(2);
|
|
|
|
|
});
|
|
|
|
|
|
2019-01-25 17:18:57 -05:00
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/1163
|
|
|
|
|
rgtest!(r1163, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create("bom.txt", "\u{FEFF}test123\ntest123");
|
|
|
|
|
eqnice!(
|
|
|
|
|
"bom.txt:test123\nbom.txt:test123\n",
|
|
|
|
|
cmd.arg("^test123").stdout()
|
|
|
|
|
);
|
|
|
|
|
});
|
|
|
|
|
|
2019-01-20 17:32:34 -08:00
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/1164
|
|
|
|
|
rgtest!(r1164, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create_dir(".git");
|
|
|
|
|
dir.create(".gitignore", "myfile");
|
|
|
|
|
dir.create("MYFILE", "test");
|
|
|
|
|
|
|
|
|
|
cmd.arg("--ignore-file-case-insensitive").arg("test").assert_err();
|
|
|
|
|
eqnice!(
|
|
|
|
|
"MYFILE:test\n",
|
|
|
|
|
cmd.arg("--no-ignore-file-case-insensitive").stdout()
|
|
|
|
|
);
|
|
|
|
|
});
|
2019-01-23 18:12:35 -05:00
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/1173
|
|
|
|
|
rgtest!(r1173, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create_dir(".git");
|
|
|
|
|
dir.create(".gitignore", "**");
|
|
|
|
|
dir.create("foo", "test");
|
|
|
|
|
cmd.arg("test").assert_err();
|
|
|
|
|
});
|
2019-01-23 19:15:02 -05:00
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/1174
|
|
|
|
|
rgtest!(r1174, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create_dir(".git");
|
|
|
|
|
dir.create(".gitignore", "**/**/*");
|
|
|
|
|
dir.create_dir("a");
|
|
|
|
|
dir.create("a/foo", "test");
|
|
|
|
|
cmd.arg("test").assert_err();
|
|
|
|
|
});
|
2019-01-26 16:00:43 -05:00
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/1176
|
|
|
|
|
rgtest!(r1176_literal_file, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create("patterns", "foo(bar\n");
|
|
|
|
|
dir.create("test", "foo(bar");
|
|
|
|
|
|
|
|
|
|
eqnice!(
|
|
|
|
|
"foo(bar\n",
|
|
|
|
|
cmd.arg("-F").arg("-f").arg("patterns").arg("test").stdout()
|
|
|
|
|
);
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/1176
|
|
|
|
|
rgtest!(r1176_line_regex, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create("patterns", "foo\n");
|
|
|
|
|
dir.create("test", "foobar\nfoo\nbarfoo\n");
|
|
|
|
|
|
|
|
|
|
eqnice!(
|
|
|
|
|
"foo\n",
|
|
|
|
|
cmd.arg("-x").arg("-f").arg("patterns").arg("test").stdout()
|
|
|
|
|
);
|
|
|
|
|
});
|
2019-02-27 17:42:14 -05:00
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/1203
|
|
|
|
|
rgtest!(r1203_reverse_suffix_literal, |dir: Dir, _: TestCommand| {
|
|
|
|
|
dir.create("test", "153.230000\n");
|
|
|
|
|
|
|
|
|
|
let mut cmd = dir.command();
|
|
|
|
|
eqnice!("153.230000\n", cmd.arg(r"\d\d\d00").arg("test").stdout());
|
|
|
|
|
|
|
|
|
|
let mut cmd = dir.command();
|
|
|
|
|
eqnice!("153.230000\n", cmd.arg(r"\d\d\d000").arg("test").stdout());
|
|
|
|
|
});
|
2019-04-19 07:10:24 -04:00
|
|
|
|
ripgrep: fix bug when CWD has directory named `-`
Specifically, when searching stdin, if the current directory has a
directory named `-`, then the `--with-filename` flag would automatically
be turned on. This is because `--with-filename` is automatically enabled
when ripgrep is given a single path that is a directory. When ripgrep is
given empty arguments, and if it is searching stdin, then its default
path list is just simple `["-"]`. The `is_dir` check passes, and
`--with-filename` gets enabled.
This commit fixes the problem by checking whether the path is `-` first.
If so, then we assume it isn't a directory. This is fine, since if it is
a directory and one asks to search it explicitly, then ripgrep will
interpret `-` as stdin anyway (which is arguably a bug on its own, but
probably not one worth fixing).
Fixes #1223, Closes #1292
2019-06-05 21:03:52 +05:30
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/1223
|
2020-02-17 18:08:47 -05:00
|
|
|
rgtest!(
|
|
|
|
|
r1223_no_dir_check_for_default_path,
|
|
|
|
|
|dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create_dir("-");
|
|
|
|
|
dir.create("a.json", "{}");
|
|
|
|
|
dir.create("a.txt", "some text");
|
|
|
|
|
|
|
|
|
|
eqnice!(
|
|
|
|
|
"a.json\na.txt\n",
|
|
|
|
|
sort_lines(&cmd.arg("a").pipe(b"a.json\na.txt"))
|
|
|
|
|
);
|
|
|
|
|
}
|
|
|
|
|
);
|
ripgrep: fix bug when CWD has directory named `-`
Specifically, when searching stdin, if the current directory has a
directory named `-`, then the `--with-filename` flag would automatically
be turned on. This is because `--with-filename` is automatically enabled
when ripgrep is given a single path that is a directory. When ripgrep is
given empty arguments, and if it is searching stdin, then its default
path list is just simple `["-"]`. The `is_dir` check passes, and
`--with-filename` gets enabled.
This commit fixes the problem by checking whether the path is `-` first.
If so, then we assume it isn't a directory. This is fine, since if it is
a directory and one asks to search it explicitly, then ripgrep will
interpret `-` as stdin anyway (which is arguably a bug on its own, but
probably not one worth fixing).
Fixes #1223, Closes #1292
2019-06-05 21:03:52 +05:30
|
|
|
|
2019-04-19 07:10:24 -04:00
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/1259
|
|
|
|
|
rgtest!(r1259_drop_last_byte_nonl, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create("patterns-nonl", "[foo]");
|
|
|
|
|
dir.create("patterns-nl", "[foo]\n");
|
|
|
|
|
dir.create("test", "fz");
|
|
|
|
|
|
|
|
|
|
eqnice!("fz\n", cmd.arg("-f").arg("patterns-nonl").arg("test").stdout());
|
|
|
|
|
cmd = dir.command();
|
|
|
|
|
eqnice!("fz\n", cmd.arg("-f").arg("patterns-nl").arg("test").stdout());
|
|
|
|
|
});
|
2019-08-01 16:58:12 -04:00
|
|
|
|
printer: fix multi-line replacement bug
This commit fixes a subtle bug in multi-line replacement of line
terminators.
The problem is that even though ripgrep supports multi-line searches, it
is *still* line oriented. It still needs to print line numbers, for
example. For this reason, there are various parts in the printer that
iterate over lines in order to format them into the desired output.
This turns out to be problematic in some cases. #1311 documents one of
those cases (with line numbers enabled to highlight a point later):
$ printf "hello\nworld\n" | rg -n -U "\n" -r "?"
1:hello?
2:world?
But the desired output is this:
$ printf "hello\nworld\n" | rg -n -U "\n" -r "?"
1:hello?world?
At first I had thought that the main problem was that the printer was
taking ownership of writing line terminators, even if the input already
had them. But it's more subtle than that. If we fix that issue, we get
output like this instead:
$ printf "hello\nworld\n" | rg -n -U "\n" -r "?"
1:hello?2:world?
Notice how '2:' is printed before 'world?'. The reason it works this way
is because matches are reported to the printer in a line oriented way.
That is, the printer gets a block of lines. The searcher guarantees that
all matches that start or end in any of those lines also end or start in
another line in that same block. As a result, the printer uses this
assumption: once it has processed a block of lines, the next match will
begin on a new and distinct line. Thus, things like '2:' are printed.
This is generally all fine and good, but an impedance mismatch arises
when replacements are used. Because now, the replacement can be used to
change the "block of lines" approach. Now, in terms of the output, the
subsequent match might actually continue the current line since the
replacement might get rid of the concept of lines altogether.
We can sometimes work around this. For example:
$ printf "hello\nworld\n" | rg -U "\n(.)?" -r '?$1'
hello?world?
Why does this work? It's because the '(.)' after the '\n' causes the
match to overlap between lines. Thus, the searcher guarantees that the
block sent to the printer contains every line.
And there in lay the solution: all we need to do is tweak the multi-line
searcher so that it combines lines with matches that directly adjacent,
instead of requiring at least one byte of overlap. Fixing that solves
the issue above. It does cause some tests to fail:
* The binary3 test in the searcher crate fails because adjacent line
matches are now one part of block, and that block is scanned for
binary data. To preserve the essence of the test, we insert a couple
dummy lines to split up the blocks.
* The JSON CRLF test. It was testing that we didn't output any messages
with an empty 'submatches' array. That is indeed still the case. The
difference is that the messages got combined because of the adjacent
line merging behavior. This is a slight change to the output, but is
still correct.
Fixes #1311
2021-05-31 06:10:48 -04:00
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/1311
|
|
|
|
|
rgtest!(r1311_multi_line_term_replace, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create("input", "hello\nworld\n");
|
|
|
|
|
eqnice!(
|
|
|
|
|
"1:hello?world?\n",
|
|
|
|
|
cmd.args(&["-U", "-r?", "-n", "\n", "input"]).stdout()
|
|
|
|
|
);
|
|
|
|
|
});
|
|
|
|
|
|
2019-09-05 13:39:08 +00:00
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/1319
|
|
|
|
|
rgtest!(r1319, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create("input", "CCAGCTACTCGGGAGGCTGAGGCTGGAGGATCGCTTGAGTCCAGGAGTTC");
|
|
|
|
|
eqnice!(
|
|
|
|
|
"input:CCAGCTACTCGGGAGGCTGAGGCTGGAGGATCGCTTGAGTCCAGGAGTTC\n",
|
2020-02-17 18:08:47 -05:00
|
|
|
cmd.arg("TTGAGTCCAGGAG[ATCG]{2}C").stdout()
|
|
|
|
|
);
|
2019-09-05 13:39:08 +00:00
|
|
|
});
|
|
|
|
|
|
2019-08-01 16:58:12 -04:00
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/1334
|
|
|
|
|
rgtest!(r1334_crazy_literals, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create("patterns", &"1.208.0.0/12\n".repeat(40));
|
|
|
|
|
dir.create("corpus", "1.208.0.0/12\n");
|
|
|
|
|
eqnice!(
|
|
|
|
|
"1.208.0.0/12\n",
|
|
|
|
|
cmd.arg("-Ff").arg("patterns").arg("corpus").stdout()
|
|
|
|
|
);
|
|
|
|
|
});
|
2019-12-11 17:41:04 +01:00
|
|
|
|
2020-07-11 18:42:54 +08:00
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/1380
|
|
|
|
|
rgtest!(r1380, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create(
|
|
|
|
|
"foo",
|
|
|
|
|
"\
|
|
|
|
|
a
|
|
|
|
|
b
|
|
|
|
|
c
|
|
|
|
|
d
|
|
|
|
|
e
|
|
|
|
|
d
|
|
|
|
|
e
|
|
|
|
|
d
|
|
|
|
|
e
|
|
|
|
|
d
|
|
|
|
|
e
|
|
|
|
|
",
|
|
|
|
|
);
|
|
|
|
|
|
|
|
|
|
eqnice!("d\ne\nd\n", cmd.args(&["-A2", "-m1", "d", "foo"]).stdout());
|
|
|
|
|
});
|
|
|
|
|
|
2020-02-17 15:59:03 -05:00
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/1389
|
|
|
|
|
rgtest!(r1389_bad_symlinks_no_biscuit, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create_dir("mydir");
|
|
|
|
|
dir.create("mydir/file.txt", "test");
|
|
|
|
|
dir.link_dir("mydir", "mylink");
|
|
|
|
|
|
2020-02-17 18:08:47 -05:00
|
|
|
let stdout = cmd
|
|
|
|
|
.args(&["test", "--no-ignore", "--sort", "path", "mylink"])
|
|
|
|
|
.stdout();
|
2020-02-17 15:59:03 -05:00
|
|
|
eqnice!("mylink/file.txt:test\n", stdout);
|
|
|
|
|
});
|
|
|
|
|
|
2021-05-31 19:00:56 -04:00
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/1401
|
|
|
|
|
rgtest!(r1401_look_ahead_only_matching_1, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
// Only PCRE2 supports look-around.
|
|
|
|
|
if !dir.is_pcre2() {
|
|
|
|
|
return;
|
|
|
|
|
}
|
|
|
|
|
dir.create("ip.txt", "foo 42\nxoyz\ncat\tdog\n");
|
|
|
|
|
cmd.args(&["-No", r".*o(?!.*\s)", "ip.txt"]);
|
|
|
|
|
eqnice!("xo\ncat\tdo\n", cmd.stdout());
|
|
|
|
|
|
|
|
|
|
let mut cmd = dir.command();
|
|
|
|
|
cmd.args(&["-No", r".*o(?!.*[ \t])", "ip.txt"]);
|
|
|
|
|
eqnice!("xo\ncat\tdo\n", cmd.stdout());
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/1401
|
|
|
|
|
rgtest!(r1401_look_ahead_only_matching_2, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
// Only PCRE2 supports look-around.
|
|
|
|
|
if !dir.is_pcre2() {
|
|
|
|
|
return;
|
|
|
|
|
}
|
|
|
|
|
dir.create("ip.txt", "foo 42\nxoyz\ncat\tdog\nfoo");
|
|
|
|
|
cmd.args(&["-No", r".*o(?!.*\s)", "ip.txt"]);
|
|
|
|
|
eqnice!("xo\ncat\tdo\nfoo\n", cmd.stdout());
|
|
|
|
|
});
|
|
|
|
|
|
grep: fix bugs in handling multi-line look-around
This commit hacks in a bug fix for handling look-around across multiple
lines. The main problem is that by the time the matching lines are sent
to the printer, the surrounding context---which some look-behind or
look-ahead might have matched---could have been dropped if it wasn't
part of the set of matching lines. Therefore, when the printer re-runs
the regex engine in some cases (to do replacements, color matches, etc
etc), it won't be guaranteed to see the same matches that the searcher
found.
Overall, this is a giant clusterfuck and suggests that the way I divided
the abstraction boundary between the printer and the searcher is just
wrong. It's likely that the searcher needs to handle more of the work of
matching and pass that info on to the printer. The tricky part is that
this additional work isn't always needed. Ultimately, this means a
serious re-design of the interface between searching and printing. Sigh.
The way this fix works is to smuggle the underlying buffer used by the
searcher through into the printer. Since these bugs only impact
multi-line search (otherwise, searches are only limited to matches
across a single line), and since multi-line search always requires
having the entire file contents in a single contiguous slice (memory
mapped or on the heap), it follows that the buffer we pass through when
we need it is, in fact, the entire haystack. So this commit refactors
the printer's regex searching to use that buffer instead of the intended
bundle of bytes containing just the relevant matching portions of that
same buffer.
There is one last little hiccup: PCRE2 doesn't seem to have a way to
specify an ending position for a search. So when we re-run the search to
find matches, we can't say, "but don't search past here." Since the
buffer is likely to contain the entire file, we really cannot do
anything here other than specify a fixed upper bound on the number of
bytes to search. So if look-ahead goes more than N bytes beyond the
match, this code will break by simply being unable to find the match. In
practice, this is probably pretty rare. I believe that if we did a
better fix for this bug by fixing the interfaces, then we'd probably try
to have PCRE2 find the pertinent matches up front so that it never needs
to re-discover them.
Fixes #1412
2021-05-31 08:29:01 -04:00
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/1412
|
|
|
|
|
rgtest!(r1412_look_behind_no_replacement, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
// Only PCRE2 supports look-around.
|
|
|
|
|
if !dir.is_pcre2() {
|
|
|
|
|
return;
|
|
|
|
|
}
|
|
|
|
|
|
|
|
|
|
dir.create("test", "foo\nbar\n");
|
|
|
|
|
cmd.args(&["-nU", "-rquux", r"(?<=foo\n)bar", "test"]);
|
|
|
|
|
eqnice!("2:quux\n", cmd.stdout());
|
|
|
|
|
});
|
|
|
|
|
|
2019-12-11 17:41:04 +01:00
|
|
|
// See: https://github.com/BurntSushi/ripgrep/pull/1446
|
2020-02-17 18:08:47 -05:00
|
|
|
rgtest!(
|
|
|
|
|
r1446_respect_excludes_in_worktree,
|
|
|
|
|
|dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create_dir("repo/.git/info");
|
|
|
|
|
dir.create("repo/.git/info/exclude", "ignored");
|
|
|
|
|
dir.create_dir("repo/.git/worktrees/repotree");
|
|
|
|
|
dir.create("repo/.git/worktrees/repotree/commondir", "../..");
|
|
|
|
|
|
|
|
|
|
dir.create_dir("repotree");
|
|
|
|
|
dir.create("repotree/.git", "gitdir: repo/.git/worktrees/repotree");
|
|
|
|
|
dir.create("repotree/ignored", "");
|
|
|
|
|
dir.create("repotree/not-ignored", "");
|
|
|
|
|
|
|
|
|
|
cmd.arg("--sort").arg("path").arg("--files").arg("repotree");
|
|
|
|
|
eqnice!("repotree/not-ignored\n", cmd.stdout());
|
|
|
|
|
}
|
|
|
|
|
);
|
2020-04-01 20:34:39 -04:00
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/1537
|
|
|
|
|
rgtest!(r1537, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create("foo", "abc;de,fg");
|
|
|
|
|
|
|
|
|
|
let expected = "foo:abc;de,fg\n";
|
|
|
|
|
eqnice!(expected, cmd.arg(";(.*,){1}").stdout());
|
|
|
|
|
});
|
2020-04-23 08:36:54 -04:00
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/1559
|
|
|
|
|
rgtest!(r1559, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create(
|
|
|
|
|
"foo",
|
|
|
|
|
"\
|
|
|
|
|
type A struct {
|
|
|
|
|
TaskID int `json:\"taskID\"`
|
|
|
|
|
}
|
|
|
|
|
|
|
|
|
|
type B struct {
|
|
|
|
|
ObjectID string `json:\"objectID\"`
|
|
|
|
|
TaskID int `json:\"taskID\"`
|
|
|
|
|
}
|
|
|
|
|
",
|
|
|
|
|
);
|
|
|
|
|
|
|
|
|
|
let expected = "\
|
|
|
|
|
foo: TaskID int `json:\"taskID\"`
|
|
|
|
|
foo: TaskID int `json:\"taskID\"`
|
|
|
|
|
";
|
|
|
|
|
eqnice!(expected, cmd.arg("TaskID +int").stdout());
|
|
|
|
|
});
|
2020-05-08 08:09:26 -04:00
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/1573
|
|
|
|
|
//
|
|
|
|
|
// Tests that if look-ahead is used, then --count-matches is correct.
|
|
|
|
|
rgtest!(r1573, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
// Only PCRE2 supports look-ahead.
|
|
|
|
|
if !dir.is_pcre2() {
|
|
|
|
|
return;
|
|
|
|
|
}
|
|
|
|
|
|
|
|
|
|
dir.create_bytes("foo", b"\xFF\xFE\x00\x62");
|
|
|
|
|
dir.create(
|
|
|
|
|
"foo",
|
|
|
|
|
"\
|
|
|
|
|
def A;
|
|
|
|
|
def B;
|
|
|
|
|
use A;
|
|
|
|
|
use B;
|
|
|
|
|
",
|
|
|
|
|
);
|
|
|
|
|
|
|
|
|
|
// Check that normal --count is correct.
|
|
|
|
|
cmd.args(&[
|
|
|
|
|
"--pcre2",
|
|
|
|
|
"--multiline",
|
|
|
|
|
"--count",
|
|
|
|
|
r"(?s)def (\w+);(?=.*use \w+)",
|
|
|
|
|
"foo",
|
|
|
|
|
]);
|
|
|
|
|
eqnice!("2\n", cmd.stdout());
|
|
|
|
|
|
|
|
|
|
// Now check --count-matches.
|
|
|
|
|
let mut cmd = dir.command();
|
|
|
|
|
cmd.args(&[
|
|
|
|
|
"--pcre2",
|
|
|
|
|
"--multiline",
|
|
|
|
|
"--count-matches",
|
|
|
|
|
r"(?s)def (\w+);(?=.*use \w+)",
|
|
|
|
|
"foo",
|
|
|
|
|
]);
|
|
|
|
|
eqnice!("2\n", cmd.stdout());
|
|
|
|
|
});
|
2021-05-15 08:23:01 -04:00
|
|
|
|
2020-10-02 16:17:39 -04:00
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/1638
|
|
|
|
|
//
|
|
|
|
|
// Tests if UTF-8 BOM is sniffed, then the column index is correct.
|
|
|
|
|
rgtest!(r1638, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create_bytes("foo", b"\xef\xbb\xbfx");
|
|
|
|
|
|
|
|
|
|
eqnice!("foo:1:1:x\n", cmd.arg("--column").arg("x").stdout());
|
|
|
|
|
});
|
|
|
|
|
|
2021-05-31 19:52:26 -04:00
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/1739
|
|
|
|
|
rgtest!(r1739_replacement_lineterm_match, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create("test", "a\n");
|
|
|
|
|
cmd.args(&[r"-r${0}f", r".*", "test"]);
|
|
|
|
|
eqnice!("af\n", cmd.stdout());
|
|
|
|
|
});
|
|
|
|
|
|
2022-08-29 22:32:29 +02:00
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/1757
|
|
|
|
|
rgtest!(f1757, |dir: Dir, _: TestCommand| {
|
|
|
|
|
dir.create_dir("rust/target");
|
|
|
|
|
dir.create(".ignore", "rust/target");
|
|
|
|
|
dir.create("rust/source.rs", "needle");
|
|
|
|
|
dir.create("rust/target/rustdoc-output.html", "needle");
|
|
|
|
|
|
|
|
|
|
let args = &["--files-with-matches", "needle", "rust"];
|
|
|
|
|
eqnice!("rust/source.rs\n", dir.command().args(args).stdout());
|
|
|
|
|
let args = &["--files-with-matches", "needle", "./rust"];
|
|
|
|
|
eqnice!("./rust/source.rs\n", dir.command().args(args).stdout());
|
|
|
|
|
});
|
|
|
|
|
|
2021-05-30 11:13:27 -04:00
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/1765
|
|
|
|
|
rgtest!(r1765, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create("test", "\n");
|
|
|
|
|
// We need to add --color=always here to force the failure, since the bad
|
|
|
|
|
// code path is only triggered when colors are enabled.
|
|
|
|
|
cmd.args(&[r"x?", "--crlf", "--color", "always"]);
|
|
|
|
|
|
|
|
|
|
assert!(!cmd.stdout().is_empty());
|
|
|
|
|
});
|
|
|
|
|
|
2023-11-25 10:39:08 -05:00
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/1838
|
|
|
|
|
rgtest!(r1838_nul_error_with_binary_detection, |dir: Dir, _: TestCommand| {
|
|
|
|
|
// We don't support this error reporting with PCRE2 since we can't parse
|
|
|
|
|
// the pattern (easily) to give a good error message.
|
|
|
|
|
if dir.is_pcre2() {
|
|
|
|
|
return;
|
|
|
|
|
}
|
|
|
|
|
dir.create("test", "foo\n");
|
|
|
|
|
|
|
|
|
|
dir.command().args(&[r"foo\x00?"]).assert_err();
|
|
|
|
|
eqnice!("test:foo\n", dir.command().args(&["-a", r"foo\x00?"]).stdout());
|
|
|
|
|
});
|
|
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/1866
|
2021-05-15 08:23:01 -04:00
|
|
|
rgtest!(r1866, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create("test", "foobar\nfoobar\nfoo quux");
|
|
|
|
|
cmd.args(&[
|
|
|
|
|
"--multiline",
|
|
|
|
|
"--vimgrep",
|
|
|
|
|
r"foobar\nfoobar\nfoo|quux",
|
|
|
|
|
"test",
|
|
|
|
|
]);
|
|
|
|
|
|
2021-05-30 21:36:35 -04:00
|
|
|
// vimgrep only wants the first line of each match, even when a match
|
|
|
|
|
// spans multiple lines.
|
|
|
|
|
//
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/1866
|
2021-05-15 08:23:01 -04:00
|
|
|
let expected = "\
|
|
|
|
|
test:1:1:foobar
|
|
|
|
|
test:3:5:foo quux
|
|
|
|
|
";
|
|
|
|
|
eqnice!(expected, cmd.stdout());
|
|
|
|
|
});
|
2021-05-29 07:34:14 -04:00
|
|
|
|
2021-05-29 11:56:43 -04:00
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/1868
|
|
|
|
|
rgtest!(r1868_context_passthru_override, |dir: Dir, _: TestCommand| {
|
|
|
|
|
dir.create("test", "foo\nbar\nbaz\nquux\n");
|
|
|
|
|
|
|
|
|
|
let args = &["-C1", "bar", "test"];
|
|
|
|
|
eqnice!("foo\nbar\nbaz\n", dir.command().args(args).stdout());
|
|
|
|
|
let args = &["--passthru", "bar", "test"];
|
|
|
|
|
eqnice!("foo\nbar\nbaz\nquux\n", dir.command().args(args).stdout());
|
|
|
|
|
|
|
|
|
|
let args = &["--passthru", "-C1", "bar", "test"];
|
|
|
|
|
eqnice!("foo\nbar\nbaz\n", dir.command().args(args).stdout());
|
|
|
|
|
let args = &["-C1", "--passthru", "bar", "test"];
|
|
|
|
|
eqnice!("foo\nbar\nbaz\nquux\n", dir.command().args(args).stdout());
|
|
|
|
|
|
|
|
|
|
let args = &["--passthru", "-B1", "bar", "test"];
|
|
|
|
|
eqnice!("foo\nbar\n", dir.command().args(args).stdout());
|
|
|
|
|
let args = &["-B1", "--passthru", "bar", "test"];
|
|
|
|
|
eqnice!("foo\nbar\nbaz\nquux\n", dir.command().args(args).stdout());
|
|
|
|
|
|
|
|
|
|
let args = &["--passthru", "-A1", "bar", "test"];
|
|
|
|
|
eqnice!("bar\nbaz\n", dir.command().args(args).stdout());
|
|
|
|
|
let args = &["-A1", "--passthru", "bar", "test"];
|
|
|
|
|
eqnice!("foo\nbar\nbaz\nquux\n", dir.command().args(args).stdout());
|
|
|
|
|
});
|
|
|
|
|
|
2021-05-29 07:34:14 -04:00
|
|
|
rgtest!(r1878, |dir: Dir, _: TestCommand| {
|
|
|
|
|
dir.create("test", "a\nbaz\nabc\n");
|
|
|
|
|
|
|
|
|
|
// Since ripgrep enables (?m) by default, '^' will match at the beginning
|
|
|
|
|
// of a line, even when -U/--multiline is used.
|
|
|
|
|
let args = &["-U", "--no-mmap", r"^baz", "test"];
|
|
|
|
|
eqnice!("baz\n", dir.command().args(args).stdout());
|
|
|
|
|
let args = &["-U", "--mmap", r"^baz", "test"];
|
|
|
|
|
eqnice!("baz\n", dir.command().args(args).stdout());
|
|
|
|
|
|
|
|
|
|
// But when (?-m) is disabled, or when \A is used, then there should be no
|
|
|
|
|
// matches that aren't anchored to the beginning of the file.
|
|
|
|
|
let args = &["-U", "--no-mmap", r"(?-m)^baz", "test"];
|
|
|
|
|
dir.command().args(args).assert_err();
|
|
|
|
|
let args = &["-U", "--mmap", r"(?-m)^baz", "test"];
|
|
|
|
|
dir.command().args(args).assert_err();
|
|
|
|
|
|
|
|
|
|
let args = &["-U", "--no-mmap", r"\Abaz", "test"];
|
|
|
|
|
dir.command().args(args).assert_err();
|
|
|
|
|
let args = &["-U", "--mmap", r"\Abaz", "test"];
|
|
|
|
|
dir.command().args(args).assert_err();
|
|
|
|
|
});
|
2021-06-12 14:16:35 -04:00
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/1891
|
|
|
|
|
rgtest!(r1891, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create("test", "\n##\n");
|
|
|
|
|
// N.B. We use -o here to force the issue to occur, which seems to only
|
|
|
|
|
// happen when each match needs to be detected.
|
2023-10-09 18:23:36 -04:00
|
|
|
eqnice!("1:\n2:\n2:\n2:\n", cmd.args(&["-won", "", "test"]).stdout());
|
2021-06-12 14:16:35 -04:00
|
|
|
});
|
2022-05-11 08:11:47 -04:00
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/2095
|
|
|
|
|
rgtest!(r2095, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create(
|
|
|
|
|
"test",
|
|
|
|
|
"#!/usr/bin/env bash
|
|
|
|
|
|
|
|
|
|
zero=one
|
|
|
|
|
|
|
|
|
|
a=one
|
|
|
|
|
|
|
|
|
|
if true; then
|
|
|
|
|
a=(
|
|
|
|
|
a
|
|
|
|
|
b
|
|
|
|
|
c
|
|
|
|
|
)
|
|
|
|
|
true
|
|
|
|
|
fi
|
|
|
|
|
|
|
|
|
|
a=two
|
|
|
|
|
|
|
|
|
|
b=one
|
|
|
|
|
});
|
|
|
|
|
",
|
|
|
|
|
);
|
|
|
|
|
cmd.args(&[
|
|
|
|
|
"--line-number",
|
|
|
|
|
"--multiline",
|
|
|
|
|
"--only-matching",
|
|
|
|
|
"--replace",
|
|
|
|
|
"${value}",
|
|
|
|
|
r"^(?P<indent>\s*)a=(?P<value>(?ms:[(].*?[)])|.*?)$",
|
|
|
|
|
"test",
|
|
|
|
|
]);
|
|
|
|
|
let expected = "4:one
|
|
|
|
|
8:(
|
|
|
|
|
9: a
|
|
|
|
|
10: b
|
|
|
|
|
11: c
|
|
|
|
|
12: )
|
|
|
|
|
15:two
|
|
|
|
|
";
|
|
|
|
|
eqnice!(expected, cmd.stdout());
|
|
|
|
|
});
|
|
|
|
|
|
2022-05-08 15:48:56 +02:00
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/2198
|
|
|
|
|
rgtest!(r2198, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create(".ignore", "a");
|
|
|
|
|
dir.create(".rgignore", "b");
|
|
|
|
|
dir.create("a", "");
|
|
|
|
|
dir.create("b", "");
|
|
|
|
|
dir.create("c", "");
|
|
|
|
|
|
|
|
|
|
cmd.arg("--files").arg("--sort").arg("path");
|
|
|
|
|
eqnice!("c\n", cmd.stdout());
|
|
|
|
|
eqnice!("a\nb\nc\n", cmd.arg("--no-ignore-dot").stdout());
|
|
|
|
|
});
|
|
|
|
|
|
2022-05-11 08:11:47 -04:00
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/2208
|
|
|
|
|
rgtest!(r2208, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create("test", "# Compile requirements.txt files from all found or specified requirements.in files (compile).
|
|
|
|
|
# Use -h to include hashes, -u dep1,dep2... to upgrade specific dependencies, and -U to upgrade all.
|
|
|
|
|
pipc () { # [-h] [-U|-u <pkgspec>[,<pkgspec>...]] [<reqs-in>...] [-- <pip-compile-arg>...]
|
|
|
|
|
emulate -L zsh
|
|
|
|
|
unset REPLY
|
|
|
|
|
if [[ $1 == --help ]] { zpy $0; return }
|
|
|
|
|
[[ $ZPY_PROCS ]] || return
|
|
|
|
|
|
|
|
|
|
local gen_hashes upgrade upgrade_csv
|
|
|
|
|
while [[ $1 == -[hUu] ]] {
|
|
|
|
|
if [[ $1 == -h ]] { gen_hashes=--generate-hashes; shift }
|
|
|
|
|
if [[ $1 == -U ]] { upgrade=1; shift }
|
|
|
|
|
if [[ $1 == -u ]] { upgrade=1; upgrade_csv=$2; shift 2 }
|
|
|
|
|
}
|
|
|
|
|
}
|
|
|
|
|
");
|
|
|
|
|
cmd.args(&[
|
|
|
|
|
"-N",
|
|
|
|
|
"-U",
|
|
|
|
|
"-r", "$usage",
|
|
|
|
|
r#"^(?P<predoc>\n?(# .*\n)*)(alias (?P<aname>pipc)="[^"]+"|(?P<fname>pipc) \(\) \{)( #(?P<usage> .+))?"#,
|
|
|
|
|
"test",
|
|
|
|
|
]);
|
|
|
|
|
let expected = " [-h] [-U|-u <pkgspec>[,<pkgspec>...]] [<reqs-in>...] [-- <pip-compile-arg>...]\n";
|
|
|
|
|
eqnice!(expected, cmd.stdout());
|
|
|
|
|
});
|
2022-06-14 10:38:32 -04:00
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/2236
|
|
|
|
|
rgtest!(r2236, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create(".ignore", r"foo\/");
|
|
|
|
|
dir.create_dir("foo");
|
|
|
|
|
dir.create("foo/bar", "test\n");
|
|
|
|
|
cmd.args(&["test"]).assert_err();
|
|
|
|
|
});
|
test: test that regex inline flags work as intended
This was originally fixed by using non-capturing groups when joining
patterns in crates/core/args.rs, but before that landed, it ended up
getting fixed via a refactor in the course of migrating to regex 1.9.
Namely, it's now fixed by pushing pattern joining down into the regex
layer, so that patterns can be joined in the most effective way
possible.
Still, #2488 contains a useful test, so we bring that in here. The
test actually failed for `rg -e ')('`, since it expected the command to
fail with a syntax error. But my refactor actually causes this command
to succeed. And indeed, #2488 worked around this by special casing a
single pattern. That work-around fixes it for the single pattern case,
but doesn't fix it for the -w or -X or multi-pattern case. So for now,
we're content to leave well enough alone. The only real way to fix this
for real is to parse each regexp individual and verify that each is
valid on its own. It's not clear that doing so is worth it.
Fixes #2480, Closes #2488
2023-04-13 08:28:16 +03:00
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/2480
|
|
|
|
|
rgtest!(r2480, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create("file", "FooBar\n");
|
|
|
|
|
|
|
|
|
|
// no regression in empty pattern behavior
|
|
|
|
|
cmd.args(&["-e", "", "file"]);
|
|
|
|
|
eqnice!("FooBar\n", cmd.stdout());
|
|
|
|
|
|
|
|
|
|
// no regression in single pattern behavior
|
|
|
|
|
let mut cmd = dir.command();
|
|
|
|
|
cmd.args(&["-e", ")(", "file"]);
|
|
|
|
|
eqnice!("FooBar\n", cmd.stdout());
|
|
|
|
|
|
|
|
|
|
// no regression in multiple patterns behavior
|
|
|
|
|
let mut cmd = dir.command();
|
|
|
|
|
cmd.args(&["--only-matching", "-e", "Foo", "-e", "Bar", "file"]);
|
|
|
|
|
eqnice!("Foo\nBar\n", cmd.stdout());
|
|
|
|
|
|
|
|
|
|
// no regression in capture groups behavior
|
|
|
|
|
let mut cmd = dir.command();
|
|
|
|
|
cmd.args(&["-e", "Fo(oB)a(r)", "--replace", "${0}_${1}_${2}${3}", "file"]);
|
|
|
|
|
eqnice!("FooBar_oB_r\n", cmd.stdout()); // note: ${3} expected to be empty
|
|
|
|
|
|
|
|
|
|
// flag does not leak into next pattern on match
|
|
|
|
|
let mut cmd = dir.command();
|
|
|
|
|
cmd.args(&["--only-matching", "-e", "(?i)foo", "-e", "bar", "file"]);
|
|
|
|
|
eqnice!("Foo\n", cmd.stdout());
|
|
|
|
|
|
|
|
|
|
// flag does not leak into next pattern on mismatch
|
|
|
|
|
let mut cmd = dir.command();
|
|
|
|
|
cmd.args(&["--only-matching", "-e", "(?i)notfoo", "-e", "bar", "file"]);
|
|
|
|
|
cmd.assert_err();
|
|
|
|
|
});
|
2023-07-31 08:51:09 -04:00
|
|
|
|
|
|
|
|
// See: https://github.com/BurntSushi/ripgrep/issues/2574
|
|
|
|
|
rgtest!(r2574, |dir: Dir, mut cmd: TestCommand| {
|
|
|
|
|
dir.create("haystack", "some.domain.com\nsome.domain.com/x\n");
|
|
|
|
|
let got = cmd
|
|
|
|
|
.args(&[
|
|
|
|
|
"--no-filename",
|
|
|
|
|
"--no-unicode",
|
|
|
|
|
"-w",
|
|
|
|
|
"-o",
|
|
|
|
|
r"(\w+\.)*domain\.(\w+)",
|
|
|
|
|
])
|
|
|
|
|
.stdout();
|
|
|
|
|
eqnice!("some.domain.com\nsome.domain.com\n", got);
|
|
|
|
|
});
|